Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20140)
Regulator Name hsa-miR-513a-3p (miRNA)
Synonyms
hsa-miR-513a-3p
    Click to Show/Hide
Gene Name hsa-miR-513a-3p
Regulator Type miRNA
MiRBase ID MIMAT0004777
Sequence
UAAAUUUCACCUUUCUGAGAAGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-513a-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oesophageal cancer ICD-11: 2B70
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 hESCCs (Esophageal squamous cancer cells)
Response regulation Downregulation of BBOX1-AS1 inhibits cell proliferation, and metastasis accelerates cell apoptosis and ferroptosis in esophageal squamous cell cancer by upregulating miR-513a-3p to reduce SLC7A11 expression. These findings may provide novel insights into the diagnosis and treatment of ESCC.
Oesophageal cancer [ICD-11: 2B70]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-513a-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 hESCCs (Esophageal squamous cancer cells)
Response regulation Downregulation of BBOX1-AS1 inhibits cell proliferation, and metastasis accelerates cell apoptosis and ferroptosis in esophageal squamous cell cancer by upregulating miR-513a-3p to reduce SLC7A11 expression. These findings may provide novel insights into the diagnosis and treatment of ESCC.
References
Ref 1 lncRNA BBOX1-AS1 silencing inhibits esophageal squamous cell cancer progression by promoting ferroptosis via miR-513a-3p/SLC7A11 axis. Eur J Pharmacol. 2022 Nov 5;934:175317. doi: 10.1016/j.ejphar.2022.175317. Epub 2022 Oct 7.