Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20139)
Regulator Name hsa-miR-486-3p (miRNA)
Synonyms
hsa-miR-486-3p
    Click to Show/Hide
Gene Name hsa-miR-486-3p
Regulator Type miRNA
MiRBase ID MIMAT0004762
Sequence
CGGGGCAGCUCAGUACAGGAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-486-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 2 (TFR2) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Intervertebral disc degeneration ICD-11: FA80
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 hNPCs (Human nucleus pulposus cells)
Response regulation Circ-STC2 and TFR2 expressions were up-regulated in intervertebral disc degeneration (IDD) tissues, and miR-486-3p expression was down-regulated. Circ-STC2 inhibits the cell viability, induced the ferroptosis of the TBHP treated NPCs via targeting miR-486-3p/TFR2 axis.
Intervertebral disc degeneration [ICD-11: FA80]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-486-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 hNPCs (Human nucleus pulposus cells)
Response regulation Circ-STC2 and TFR2 expressions were up-regulated in intervertebral disc degeneration (IDD) tissues, and miR-486-3p expression was down-regulated. Circ-STC2 inhibits the cell viability, induced the ferroptosis of the TBHP treated NPCs via targeting miR-486-3p/TFR2 axis.
References
Ref 1 Circ-STC2 promotes the ferroptosis of nucleus pulposus cells via targeting miR-486-3p/TFR2 axis. J Orthop Surg Res. 2023 Jul 21;18(1):518. doi: 10.1186/s13018-023-04010-1.