General Information of the Ferroptosis Regulator (ID: REG20138)
Regulator Name hsa-miR-423-5p (miRNA)
Synonyms
hsa-miR-423-5p
    Click to Show/Hide
Gene Name hsa-miR-423-5p
Regulator Type miRNA
MiRBase ID MIMAT0004748
Sequence
UGAGGGGCAGAGAGCGAGACUUU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-423-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Stearoyl-CoA desaturase (SCD) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Colon cancer ICD-11: 2B90
Pathway Response Wnt signaling pathway hsa04310
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell stemness
In Vitro Model
SW480 cells Colon adenocarcinoma Homo sapiens CVCL_0546
HT29 cells Colon cancer Mus musculus CVCL_A8EZ
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Four-week-old female nude mice were purchased from Cavens (Changzhou, China). Nude mice were randomly divided into four groups. SW480 and HT29 cells infected with sh-LINC01606, Lv-LINC01606 and control vectors were subcutaneously implanted in mice (n = 6 per group), respectively. Tumour volumes (V = length x width2/2) were measured every 3 days, and tumour weights were determined after 4 weeks.

    Click to Show/Hide
Response regulation LINC01606 functions as an oncogene to facilitate tumor cell stemness, proliferation and inhibit ferroptosis and is a promising therapeutic target for colon cancer. Mechanistically, LINC01606 enhanced the expression of stearoyl-CoA desaturase 1 (SCD1), serving as a competing endogenous RNA to modulate miR-423-5p expression, subsequently activating the canonical Wnt/-catenin signaling, and transcription factor binding to IGHM enhancer 3 (TFE3) increased LINC01606 transcription after recruitment to the promoter regions of LINC01606.
Colon cancer [ICD-11: 2B90]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-423-5p (miRNA) miRNA
Pathway Response Wnt signaling pathway hsa04310
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell stemness
In Vitro Model
SW480 cells Colon adenocarcinoma Homo sapiens CVCL_0546
HT29 cells Colon cancer Mus musculus CVCL_A8EZ
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Four-week-old female nude mice were purchased from Cavens (Changzhou, China). Nude mice were randomly divided into four groups. SW480 and HT29 cells infected with sh-LINC01606, Lv-LINC01606 and control vectors were subcutaneously implanted in mice (n = 6 per group), respectively. Tumour volumes (V = length x width2/2) were measured every 3 days, and tumour weights were determined after 4 weeks.

    Click to Show/Hide
Response regulation LINC01606 functions as an oncogene to facilitate tumor cell stemness, proliferation and inhibit ferroptosis and is a promising therapeutic target for colon cancer. Mechanistically, LINC01606 enhanced the expression of stearoyl-CoA desaturase 1 (SCD1), serving as a competing endogenous RNA to modulate miR-423-5p expression, subsequently activating the canonical Wnt/-catenin signaling, and transcription factor binding to IGHM enhancer 3 (TFE3) increased LINC01606 transcription after recruitment to the promoter regions of LINC01606.
References
Ref 1 Long noncoding RNA LINC01606 protects colon cancer cells from ferroptotic cell death and promotes stemness by SCD1-Wnt/-catenin-TFE3 feedback loop signalling. Clin Transl Med. 2022 Apr;12(4):e752. doi: 10.1002/ctm2.752.