Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20136)
Regulator Name hsa-miR-193a-5p (miRNA)
Synonyms
hsa-miR-193a-5p
    Click to Show/Hide
Gene Name hsa-miR-193a-5p
Regulator Type miRNA
MiRBase ID MIMAT0004614
Sequence
UGGGUCUUUGCGGGCGAGAUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-193a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Cervical cancer ICD-11: 2C77
 Disease Info 
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 SiHa cells Cervical squamous cell carcinoma Homo sapiens CVCL_0032
HeLa cells Endocervical adenocarcinoma Homo sapiens CVCL_0030
Response regulation miR-193a-5p was able to target GPX4 and circACAP2 promoted GPX4 expression by sponging miR-193a-5p in cervical cancer cells.Therefore, we concluded that circular RNA circACAP2 repressed ferroptosis of cervical cancer during malignant progression by miR-193a-5p/GPX4.
Cervical cancer [ICD-11: 2C77]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-193a-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 SiHa cells Cervical squamous cell carcinoma Homo sapiens CVCL_0032
HeLa cells Endocervical adenocarcinoma Homo sapiens CVCL_0030
Response regulation miR-193a-5p was able to target GPX4 and circACAP2 promoted GPX4 expression by sponging miR-193a-5p in cervical cancer cells.Therefore, we concluded that circular RNA circACAP2 repressed ferroptosis of cervical cancer during malignant progression by miR-193a-5p/GPX4.
References
Ref 1 Circular RNA circACAP2 Suppresses Ferroptosis of Cervical Cancer during Malignant Progression by miR-193a-5p/GPX4. J Oncol. 2022 Jul 8;2022:5228874. doi: 10.1155/2022/5228874. eCollection 2022.