Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20135)
Regulator Name hsa-miR-188-3p (miRNA)
Synonyms
hsa-miR-188-3p
    Click to Show/Hide
Gene Name hsa-miR-188-3p
Regulator Type miRNA
MiRBase ID MIMAT0004613
Sequence
CUCCCACAUGCAGGGUUUGCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-188-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Chronic kidney disease ICD-11: GB61
 Disease Info 
Responsed Drug Germacrone Investigative
 Drug Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 MPC-5 cells Normal Mus musculus CVCL_AS87
In Vivo Model
C57BL/6J mice were purchased from Three Gorges University (Yichang, China), and C57BL/KsJ and male db/db mice were from Changzhou Cavins Laboratory Animal Co. Ltd. (Changzhou, China). All experiments were approved by the Animal Ethics Committee of Zhejiang Provincial People's Hospital, and performed according to specific institutional and national guidelines. The mice were divided into three groups: control C57BL/6J mice, db/db mice, and germacrone-treated db/db mice (db/db + Ger) (n = 10/each group). The db/db + Ger mice received germacrone treatment at a dosage of 10 mg/kg/day, while C57BL/6J mice and db/db mice had been given the same volumes of 0.9% saline simultaneously.

    Click to Show/Hide
Response regulation mmu_circRNA_0000309 silence mediates drug resistance to germacrone in Diabetic nephropathy mice. mmu_circRNA_0000309 sponges miR-188-3p, and subsequently upregulates GPX4 expression, inactivating ferroptosis-dependent mitochondrial function and podocyte apoptosis.
Chronic kidney disease [ICD-11: GB61]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-188-3p (miRNA) miRNA
 Regulator Info 
Responsed Drug Germacrone Investigative
 Drug Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 MPC-5 cells Normal Mus musculus CVCL_AS87
In Vivo Model
C57BL/6J mice were purchased from Three Gorges University (Yichang, China), and C57BL/KsJ and male db/db mice were from Changzhou Cavins Laboratory Animal Co. Ltd. (Changzhou, China). All experiments were approved by the Animal Ethics Committee of Zhejiang Provincial People's Hospital, and performed according to specific institutional and national guidelines. The mice were divided into three groups: control C57BL/6J mice, db/db mice, and germacrone-treated db/db mice (db/db + Ger) (n = 10/each group). The db/db + Ger mice received germacrone treatment at a dosage of 10 mg/kg/day, while C57BL/6J mice and db/db mice had been given the same volumes of 0.9% saline simultaneously.

    Click to Show/Hide
Response regulation mmu_circRNA_0000309 silence mediates drug resistance to germacrone in Diabetic nephropathy mice. mmu_circRNA_0000309 sponges miR-188-3p, and subsequently upregulates GPX4 expression, inactivating ferroptosis-dependent mitochondrial function and podocyte apoptosis.
Germacrone [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Phospholipid hydroperoxide glutathione peroxidase (GPX4) Suppressor
 Target Info 
Responsed Disease Chronic kidney disease ICD-11: GB61
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 MPC-5 cells Normal Mus musculus CVCL_AS87
In Vivo Model
C57BL/6J mice were purchased from Three Gorges University (Yichang, China), and C57BL/KsJ and male db/db mice were from Changzhou Cavins Laboratory Animal Co. Ltd. (Changzhou, China). All experiments were approved by the Animal Ethics Committee of Zhejiang Provincial People's Hospital, and performed according to specific institutional and national guidelines. The mice were divided into three groups: control C57BL/6J mice, db/db mice, and germacrone-treated db/db mice (db/db + Ger) (n = 10/each group). The db/db + Ger mice received germacrone treatment at a dosage of 10 mg/kg/day, while C57BL/6J mice and db/db mice had been given the same volumes of 0.9% saline simultaneously.

    Click to Show/Hide
Response regulation mmu_circRNA_0000309 silence mediates drug resistance to germacrone in Diabetic nephropathy mice. mmu_circRNA_0000309 sponges miR-188-3p, and subsequently upregulates GPX4 expression, inactivating ferroptosis-dependent mitochondrial function and podocyte apoptosis.
References
Ref 1 A Novel Identified Circular RNA, mmu_mmu_circRNA_0000309, Involves in Germacrone-Mediated Improvement of Diabetic Nephropathy Through Regulating Ferroptosis by Targeting miR-188-3p/GPX4 Signaling Axis. Antioxid Redox Signal. 2022 Apr;36(10-12):740-759. doi: 10.1089/ars.2021.0063.