Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20134)
Regulator Name hsa-miR-770-5p (miRNA)
Synonyms
hsa-miR-770-5p
    Click to Show/Hide
Gene Name hsa-miR-770-5p
Regulator Type miRNA
MiRBase ID MIMAT0003948
Sequence
UCCAGUACCACGUGUCAGGGCCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-770-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Chronic kidney disease ICD-11: GB61
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 mKTs (Mouse knee tissues)
HK-2 (Human renal glomerular endothelial cells)
In Vivo Model
All C57BL/6 mice (5-6 weeks, 18-20 g) were obtained from Animal Testing Center of Qinglongshan (Nanjing, Suzhou, China). DN mice were fed with a high-fat diet (HFD) for 12 weeks and then injected with STZ (30 mg/kg of streptozotocin; Sigma-Aldrich, St Louis, MO, USA) i.p. for 7 consecutive days. Blood glucose levels of mice were measured using 16.7 mmol/l after one week of the final injection. Then, mice were killed under anesthesia and their kidneys taken for analysis after induction of STZ at 4 months.

    Click to Show/Hide
Response regulation Circular RNA circ ASAP2 decreased inflammation and ferroptosis in diabetic nephropathy through SOX2/ SLC7A11 by miR-770-5p. Importantly, this research indicated that circ ASAP2 might act as a target for improving the role of ferroptosis in diabetes nephropathy.
Chronic kidney disease [ICD-11: GB61]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-770-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 mKTs (Mouse knee tissues)
HK-2 (Human renal glomerular endothelial cells)
In Vivo Model
All C57BL/6 mice (5-6 weeks, 18-20 g) were obtained from Animal Testing Center of Qinglongshan (Nanjing, Suzhou, China). DN mice were fed with a high-fat diet (HFD) for 12 weeks and then injected with STZ (30 mg/kg of streptozotocin; Sigma-Aldrich, St Louis, MO, USA) i.p. for 7 consecutive days. Blood glucose levels of mice were measured using 16.7 mmol/l after one week of the final injection. Then, mice were killed under anesthesia and their kidneys taken for analysis after induction of STZ at 4 months.

    Click to Show/Hide
Response regulation Circular RNA circ ASAP2 decreased inflammation and ferroptosis in diabetic nephropathy through SOX2/ SLC7A11 by miR-770-5p. Importantly, this research indicated that circ ASAP2 might act as a target for improving the role of ferroptosis in diabetes nephropathy.
References
Ref 1 Circ ASAP2 decreased inflammation and ferroptosis in diabetic nephropathy through SOX2/SLC7A11 by miR-770-5p. Acta Diabetol. 2023 Jan;60(1):29-42. doi: 10.1007/s00592-022-01961-5. Epub 2022 Sep 24.