Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20129)
Regulator Name hsa-miR-515-5p (miRNA)
Synonyms
hsa-miR-515-5p
    Click to Show/Hide
Gene Name hsa-miR-515-5p
Regulator Type miRNA
MiRBase ID MIMAT0002826
Sequence
UUCUCCAAAAGAAAGCACUUUCUG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-515-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Cervical cancer ICD-11: 2C77
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 Ca Ski cells Cervical squamous cell carcinoma Homo sapiens CVCL_1100
HeLa cells Endocervical adenocarcinoma Homo sapiens CVCL_0030
hCECs (Human cervical epithelial cells)
In Vivo Model
The 4-week-old female BALB/c nude mice were used for constructing xenograft model. HeLa cells (1 x 107 cells/mL) were injected into the dorsal flanksusing using 1-mL syringes. Then tumor size was measured and mice received intertumoral injection of si-crEPSTI1-1 (40 uL siRNA1 for cicrEPSTI1) and negative control (40 uL negative control) every four days, respectively (5 mice/group). After 28 days, the mice were sacrificed and xenografts were measured.

    Click to Show/Hide
Response regulation CircEPSTI1 sponges miR-375, miR-409-3p and miR-515-5p to upregulate SLC7A11 expression. CircEPSTI1-miR-375/409-3P/ 515-5p-SLC7A11 axis affected the proliferation of cervical cancer via the competing endogenous RNAs (ceRNA) mechanism and was relative to ferroptosis.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Ovarian dysfunction ICD-11: 5A80
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 KGN cells Ovarian granulosa cell tumor Homo sapiens CVCL_0375
SVOG-3e cells Normal Homo sapiens CVCL_IN98
In Vivo Model
We recruited 12 infertility patients (6 PCOS and 6 controls) aged 20 and 38 who underwent in vitro fertilization (IVF) at the Department of Reproductive Medicine Center, the First Affiliated Hospital of Sun Yat-Sen University. All patients were treated the antagonist stimulation protocol. Briefly, on cycle day 2, ovarian stimulation was started by daily injection of recombinant FSH (r-FSH) (Gonal-F; Merck Serono). Gonadotropin-releasing hormone (GnRH) antagonist (Cetrotide, 0.25 mg; Merck Serono) injection was started from the day 6 of stimulation. When at least three follicles had reached 17 mm or two follicles had reached 18 mm in diameter, an intramuscular injection of 5,000 IU-10000 IU of human chorionic gonadotropin (hCG) is used for triggering final oocyte maturation.

    Click to Show/Hide
Response regulation circRHBG inhibits ferroptosis in Polycystic ovary syndrome cells through the circRHBG/ miR-515-5p/SLC7A11 axis in PCOS, which may provide new diagnostic molecular markers and therapeutic targets for PCOS.
Cervical cancer [ICD-11: 2C77]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-515-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 Ca Ski cells Cervical squamous cell carcinoma Homo sapiens CVCL_1100
HeLa cells Endocervical adenocarcinoma Homo sapiens CVCL_0030
hCECs (Human cervical epithelial cells)
In Vivo Model
The 4-week-old female BALB/c nude mice were used for constructing xenograft model. HeLa cells (1 x 107 cells/mL) were injected into the dorsal flanksusing using 1-mL syringes. Then tumor size was measured and mice received intertumoral injection of si-crEPSTI1-1 (40 uL siRNA1 for cicrEPSTI1) and negative control (40 uL negative control) every four days, respectively (5 mice/group). After 28 days, the mice were sacrificed and xenografts were measured.

    Click to Show/Hide
Response regulation CircEPSTI1 sponges miR-375, miR-409-3p and miR-515-5p to upregulate SLC7A11 expression. CircEPSTI1-miR-375/409-3P/ 515-5p-SLC7A11 axis affected the proliferation of cervical cancer via the competing endogenous RNAs (ceRNA) mechanism and was relative to ferroptosis.
Ovarian dysfunction [ICD-11: 5A80]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-515-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 KGN cells Ovarian granulosa cell tumor Homo sapiens CVCL_0375
SVOG-3e cells Normal Homo sapiens CVCL_IN98
In Vivo Model
We recruited 12 infertility patients (6 PCOS and 6 controls) aged 20 and 38 who underwent in vitro fertilization (IVF) at the Department of Reproductive Medicine Center, the First Affiliated Hospital of Sun Yat-Sen University. All patients were treated the antagonist stimulation protocol. Briefly, on cycle day 2, ovarian stimulation was started by daily injection of recombinant FSH (r-FSH) (Gonal-F; Merck Serono). Gonadotropin-releasing hormone (GnRH) antagonist (Cetrotide, 0.25 mg; Merck Serono) injection was started from the day 6 of stimulation. When at least three follicles had reached 17 mm or two follicles had reached 18 mm in diameter, an intramuscular injection of 5,000 IU-10000 IU of human chorionic gonadotropin (hCG) is used for triggering final oocyte maturation.

    Click to Show/Hide
Response regulation circRHBG inhibits ferroptosis in Polycystic ovary syndrome cells through the circRHBG/ miR-515-5p/SLC7A11 axis in PCOS, which may provide new diagnostic molecular markers and therapeutic targets for PCOS.
References
Ref 1 Circular RNA circEPSTI1 accelerates cervical cancer progression via miR-375/409-3P/515-5p-SLC7A11 axis. Aging (Albany NY). 2021 Feb 2;13(3):4663-4673. doi: 10.18632/aging.202518. Epub 2021 Feb 2.
Ref 2 Involvement of ferroptosis in the granulosa cells proliferation of PCOS through the circRHBG/miR-515/SLC7A11 axis. Ann Transl Med. 2021 Aug;9(16):1348. doi: 10.21037/atm-21-4174.