Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20123)
Regulator Name hsa-miR-372-3p (miRNA)
Synonyms
hsa-miR-372-3p
    Click to Show/Hide
Gene Name hsa-miR-372-3p
Regulator Type miRNA
MiRBase ID MIMAT0000724
Sequence
AAAGUGCUGCGACAUUUGAGCGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-372-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oesophageal cancer ICD-11: 2B70
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
TE-1 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1759
Eca-109 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_6898
HET-1A cells Normal Homo sapiens CVCL_3702
Response regulation ARHGEF26-AS1 facilitated ferroptosis but restrained cell growth and positively regulated ADAM23 by sponging miR-372-3p in esophageal squamous cell carcinoma (ESCC). Overexpression of ARHGEF26-AS1 upregulated the protein levels of ADAM23 but depleted the protein levels of GPX4, SLC3A2, and SLC7A11.
4F2 cell-surface antigen heavy chain (SLC3A2) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Oesophageal cancer ICD-11: 2B70
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
TE-1 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1759
Eca-109 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_6898
HET-1A cells Normal Homo sapiens CVCL_3702
Response regulation ARHGEF26-AS1 facilitated ferroptosis but restrained cell growth and positively regulated ADAM23 by sponging miR-372-3p in esophageal squamous cell carcinoma (ESCC). Overexpression of ARHGEF26-AS1 upregulated the protein levels of ADAM23 but depleted the protein levels of GPX4, SLC3A2, and SLC7A11.
Oesophageal cancer [ICD-11: 2B70]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-372-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
TE-1 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1759
Eca-109 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_6898
HET-1A cells Normal Homo sapiens CVCL_3702
Response regulation ARHGEF26-AS1 facilitated ferroptosis but restrained cell growth and positively regulated ADAM23 by sponging miR-372-3p in esophageal squamous cell carcinoma (ESCC). Overexpression of ARHGEF26-AS1 upregulated the protein levels of ADAM23 but depleted the protein levels of GPX4, SLC3A2, and SLC7A11.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-372-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
In Vitro Model
 EC9706 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_E307
TE-1 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_1759
Eca-109 cells Esophageal squamous cell carcinoma Homo sapiens CVCL_6898
HET-1A cells Normal Homo sapiens CVCL_3702
Response regulation ARHGEF26-AS1 facilitated ferroptosis but restrained cell growth and positively regulated ADAM23 by sponging miR-372-3p in esophageal squamous cell carcinoma (ESCC). Overexpression of ARHGEF26-AS1 upregulated the protein levels of ADAM23 but depleted the protein levels of GPX4, SLC3A2, and SLC7A11.
References
Ref 1 Mechanism and Role of the Neuropeptide LGI1 Receptor ADAM23 in Regulating Biomarkers of Ferroptosis and Progression of Esophageal Cancer. Dis Markers. 2021 Dec 30;2021:9227897. doi: 10.1155/2021/9227897. eCollection 2021.