General Information of the Ferroptosis Regulator (ID: REG20121)
Regulator Name hsa-miR-299-3p (miRNA)
Synonyms
hsa-miR-299-3p
    Click to Show/Hide
Gene Name hsa-miR-299-3p
Regulator Type miRNA
MiRBase ID MIMAT0000687
Sequence
UAUGUGGGAUGGUAAACCGCUU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-299-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Sodium-coupled neutral amino acid symporter 1 (SLC38A1) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Lung cancer ICD-11: 2C25
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1975 cells Lung adenocarcinoma Homo sapiens CVCL_1511
BEAS-2B cells Normal Homo sapiens CVCL_0168
In Vivo Model
Male nude mice (5-week-old) were purchased from Jinan Pengyue Animal Breeding Center (Jinan, China). Next, mice models were established by subcutaneously injecting A549 cells (1 x 106 cells/100 uL) into the right armpit flanks, which were stably transfected with sh-NC or sh-OGFRP1. Tumor formation was monitored and tumor volume was calculated every week for 5 weeks according to the formula: tumor volume = 1/2 (length x width2). Totally 35 days upon injection, the mice were euthanized and the tumors were dissected out from the right armpit flanks and weighted. The tumor tissues of nude mice with lung cancer were snap-frozen in liquid nitrogen immediately and stored at -80 for further research.

    Click to Show/Hide
Response regulation OGFRP1 knockdown suppressed cell proliferation and facilitated ferroptosis by promoting lipid peroxidation and iron accumulation in lung cancer. OGFRP1 regulated cell proliferation and ferroptosis in lung cancer by inhibiting miR-299-3p to enhance SLC38A1 expression, providing a novel therapeutic strategy for lung cancer.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-299-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1975 cells Lung adenocarcinoma Homo sapiens CVCL_1511
BEAS-2B cells Normal Homo sapiens CVCL_0168
In Vivo Model
Male nude mice (5-week-old) were purchased from Jinan Pengyue Animal Breeding Center (Jinan, China). Next, mice models were established by subcutaneously injecting A549 cells (1 x 106 cells/100 uL) into the right armpit flanks, which were stably transfected with sh-NC or sh-OGFRP1. Tumor formation was monitored and tumor volume was calculated every week for 5 weeks according to the formula: tumor volume = 1/2 (length x width2). Totally 35 days upon injection, the mice were euthanized and the tumors were dissected out from the right armpit flanks and weighted. The tumor tissues of nude mice with lung cancer were snap-frozen in liquid nitrogen immediately and stored at -80 for further research.

    Click to Show/Hide
Response regulation OGFRP1 knockdown suppressed cell proliferation and facilitated ferroptosis by promoting lipid peroxidation and iron accumulation in lung cancer. OGFRP1 regulated cell proliferation and ferroptosis in lung cancer by inhibiting miR-299-3p to enhance SLC38A1 expression, providing a novel therapeutic strategy for lung cancer.
References
Ref 1 Long non-coding RNA OGFRP1 regulates cell proliferation and ferroptosis by miR-299-3p/SLC38A1 axis in lung cancer. Anticancer Drugs. 2022 Oct 1;33(9):826-839. doi: 10.1097/CAD.0000000000001328. Epub 2022 Aug 31.