Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20120)
Regulator Name hsa-miR-106b-5p (miRNA)
Synonyms
hsa-miR-106b-5p
    Click to Show/Hide
Gene Name hsa-miR-106b-5p
Regulator Type miRNA
MiRBase ID MIMAT0000680
Sequence
UAAAGUGCUGACAGUGCAGAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-106b-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Intracerebral hemorrhage ICD-11: 8B00
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 mBMVECs (Mouse brain microvascular endothelial cells)
Response regulation LncRNA H19 was overexpressed in Intracerebral hemorrhage (ICH). Knockdown of H19 promoted cell proliferation and suppressed BMVECs ferroptosis by regulating the miR-106b-5p/ACSL4 axis. Therefore, H19 knockdown may be a promising therapeutic strategy for ICH.
Intracerebral hemorrhage [ICD-11: 8B00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-106b-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 mBMVECs (Mouse brain microvascular endothelial cells)
Response regulation LncRNA H19 was overexpressed in Intracerebral hemorrhage (ICH). Knockdown of H19 promoted cell proliferation and suppressed BMVECs ferroptosis by regulating the miR-106b-5p/ACSL4 axis. Therefore, H19 knockdown may be a promising therapeutic strategy for ICH.
References
Ref 1 Long non-coding RNA H19 protects against intracerebral hemorrhage injuries via regulating microRNA-106b-5p/acyl-CoA synthetase long chain family member 4 axis. Bioengineered. 2021 Dec;12(1):4004-4015. doi: 10.1080/21655979.2021.1951070.