Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20119)
Regulator Name hsa-miR-152-3p (miRNA)
Synonyms
hsa-miR-152-3p
    Click to Show/Hide
Gene Name hsa-miR-152-3p
Regulator Type miRNA
MiRBase ID MIMAT0000438
Sequence
UCAGUGCAUGACAGAACUUGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-152-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Acute myocardial infarction ICD-11: BA41
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Autophagy hsa04140
Cell Process Cell ferroptosis
Cell autophagy
In Vitro Model
 HL-1 cells Normal Mus musculus CVCL_0303
In Vivo Model
C57BL/6J male mice of SPF grade, 8-10 weeks old, were used. The day before operation, the mice in the MI + ferrostatin-1 (Fer-1) group were injected a dose of 1 mg/kg ferroptosis inhibitor Fer-1 (SML0583-5MG, Sigma-Aldrich, USA). Fer-1 was dissolved in dimethyl sulfoxide (DMSO), then diluted in sterile saline. The sham group and the MI + NS group were injected with the same dose of saline (NS). The mice were anesthetized by 3% pentobarbital sodium via intraperitoneal injection, and the MI model was established by ligating the anterior descending branch of the left coronary artery (LAD) for 30 min.

    Click to Show/Hide
Response regulation CircRNA1615 inhibited ferroptosis in cardiomyocytes, and circRNA1615 could regulate the expression of LRP6 through sponge adsorption of miR-152-3p, prevent LRP6-mediated autophagy-related ferroptosis in cardiomyocytes, and finally control the pathological process of myocardial infarction.
Acute myocardial infarction [ICD-11: BA41]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-152-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Autophagy hsa04140
Cell Process Cell ferroptosis
Cell autophagy
In Vitro Model
 HL-1 cells Normal Mus musculus CVCL_0303
In Vivo Model
C57BL/6J male mice of SPF grade, 8-10 weeks old, were used. The day before operation, the mice in the MI + ferrostatin-1 (Fer-1) group were injected a dose of 1 mg/kg ferroptosis inhibitor Fer-1 (SML0583-5MG, Sigma-Aldrich, USA). Fer-1 was dissolved in dimethyl sulfoxide (DMSO), then diluted in sterile saline. The sham group and the MI + NS group were injected with the same dose of saline (NS). The mice were anesthetized by 3% pentobarbital sodium via intraperitoneal injection, and the MI model was established by ligating the anterior descending branch of the left coronary artery (LAD) for 30 min.

    Click to Show/Hide
Response regulation CircRNA1615 inhibited ferroptosis in cardiomyocytes, and circRNA1615 could regulate the expression of LRP6 through sponge adsorption of miR-152-3p, prevent LRP6-mediated autophagy-related ferroptosis in cardiomyocytes, and finally control the pathological process of myocardial infarction.
References
Ref 1 Effect and Mechanism of LRP6 on Cardiac Myocyte Ferroptosis in Myocardial Infarction. Oxid Med Cell Longev. 2021 Oct 19;2021:8963987. doi: 10.1155/2021/8963987. eCollection 2021.