Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20116)
Regulator Name hsa-miR-128-3p (miRNA)
Synonyms
hsa-miR-128-3p
    Click to Show/Hide
Gene Name hsa-miR-128-3p
Regulator Type miRNA
MiRBase ID MIMAT0000424
Sequence
UCACAGUGAACCGGUCUCUUU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-128-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Prostate cancer ICD-11: 2C82
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 PC-3 cells Prostate carcinoma Homo sapiens CVCL_0035
DU145 cells Prostate carcinoma Homo sapiens CVCL_0105
In Vivo Model
A total of 2 x 106 PC3 and PC3/Cd cells were subcutaneously injected into the right flanks of 4-week-old male Balb/c nude mice. Tumor burdens were closely monitored by tumor volumes. When the largest tumors reached a size of 1.0 cm3, all mice were sacrificed due to ethical considerations. Moreover, the final tumor weight was also recorded.

    Click to Show/Hide
Response regulation OIP5-AS1 served as an endogenous sponge of miR-128-3p to regulate the expression of SLC7A11, a surrogate marker of ferroptosis. Moreover, miR-128-3p decreased cell viability by enhancing ferroptosis. Taken together, lncRNA OIP5-AS1 promotes prostate cancer progression and ferroptosis resistance through miR-128-3p/SLC7A11 signaling.
Prostate cancer [ICD-11: 2C82]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-128-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 PC-3 cells Prostate carcinoma Homo sapiens CVCL_0035
DU145 cells Prostate carcinoma Homo sapiens CVCL_0105
In Vivo Model
A total of 2 x 106 PC3 and PC3/Cd cells were subcutaneously injected into the right flanks of 4-week-old male Balb/c nude mice. Tumor burdens were closely monitored by tumor volumes. When the largest tumors reached a size of 1.0 cm3, all mice were sacrificed due to ethical considerations. Moreover, the final tumor weight was also recorded.

    Click to Show/Hide
Response regulation OIP5-AS1 served as an endogenous sponge of miR-128-3p to regulate the expression of SLC7A11, a surrogate marker of ferroptosis. Moreover, miR-128-3p decreased cell viability by enhancing ferroptosis. Taken together, lncRNA OIP5-AS1 promotes prostate cancer progression and ferroptosis resistance through miR-128-3p/SLC7A11 signaling.
References
Ref 1 LncRNA OIP5-AS1 inhibits ferroptosis in prostate cancer with long-term cadmium exposure through miR-128-3p/SLC7A11 signaling. Ecotoxicol Environ Saf. 2021 Sep 1;220:112376. doi: 10.1016/j.ecoenv.2021.112376. Epub 2021 May 26.