General Information of the Ferroptosis Regulator (ID: REG20100)
Regulator Name mmu-miR-375-3p (miRNA)
Synonyms
mmu-miR-375-3p
    Click to Show/Hide
Gene Name mmu-miR-375-3p
Regulator Type miRNA
MiRBase ID MIMAT0000739
Sequence
UUUGUUCGUUCGGCUCGCGUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-375-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Natural resistance-associated macrophage protein 2 (SLC11A2) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Ulcerative colitis ICD-11: DD71
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
hCCs (Colon cells)
In Vivo Model
Mice were orally administered 0.1 g/kg Co-Q10 daily for 8 weeks after the DMM model was established to investigate the therapeutic effect of Co-Q10 in GPX4-CKO mice with osteoarthritis. Mice and rats were anaesthetized with pentobarbital. Destabilization of the medial meniscus (DMM) surgery was performed under a microscope. The incision was sutured and disinfected daily until it healed.

    Click to Show/Hide
Response regulation IRF7 upregulated SLC11A2 transcription by inhibiting miR-375-3p expression, thereby prompting ferroptosis of colonic ECs and ulcerative colitis progression in DSS-treated mice.
Ulcerative colitis [ICD-11: DD71]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-375-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
hCCs (Colon cells)
In Vivo Model
Mice were orally administered 0.1 g/kg Co-Q10 daily for 8 weeks after the DMM model was established to investigate the therapeutic effect of Co-Q10 in GPX4-CKO mice with osteoarthritis. Mice and rats were anaesthetized with pentobarbital. Destabilization of the medial meniscus (DMM) surgery was performed under a microscope. The incision was sutured and disinfected daily until it healed.

    Click to Show/Hide
Response regulation IRF7 upregulated SLC11A2 transcription by inhibiting miR-375-3p expression, thereby prompting ferroptosis of colonic ECs and ulcerative colitis progression in DSS-treated mice.
References
Ref 1 Promotive role of IRF7 in ferroptosis of colonic epithelial cells in ulcerative colitis by the miR-375-3p/SLC11A2 axis. Biomol Biomed. 2023 May 1;23(3):437-449. doi: 10.17305/bjbms.2022.8081.