General Information of the Ferroptosis Regulator (ID: REG20098)
Regulator Name mmu-miR-182-5p (miRNA)
Synonyms
mmu-miR-182-5p
    Click to Show/Hide
Gene Name mmu-miR-182-5p
Regulator Type miRNA
MiRBase ID MIMAT0000211
Sequence
UUUGGCAAUGGUAGAACUCACACCG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-182-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Kidney injury ICD-11: NB92
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
HK-2 cells Normal Homo sapiens CVCL_0302
TCMK-1 cells Normal Mus musculus CVCL_2772
In Vivo Model
Male Sprague-Dawley (SD) rats (5 weeks old, weighting 180-220 g) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. SD rats were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital sodium (25 mg/kg) and placed on a surgical thermostator. Then the rats were subjected to an abdominal incision, and the right kidney was carefully liberated from surrounding tissue, and nephrectomy was performed. The left kidney was exposed after a midline incision, and the renal artery was clamped with non-traumatic clamps for 45 min, followed by restoring of the renal blood flow. The kidneys were harvested and the serum was collected 48 h after the surgery. The rats in sham group were subjected to an abdominal incision without clamping the renal artery.

    Click to Show/Hide
Response regulation MiR-182-5p and miR-378a-3p induced ferroptosis in cells. And miR-182-5p and miR-378a-3p regulated the expression of GPX4 and SLC7A11 negatively by directly binding to the 3'UTR of GPX4 and SLC7A11 mRNA. In vivo study showed that silencing miR-182-5p and miR-378a-3p alleviated the I/R-induced kidney injury in rats.
Kidney injury [ICD-11: NB92]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-182-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
HK-2 cells Normal Homo sapiens CVCL_0302
TCMK-1 cells Normal Mus musculus CVCL_2772
In Vivo Model
Male Sprague-Dawley (SD) rats (5 weeks old, weighting 180-220 g) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. SD rats were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital sodium (25 mg/kg) and placed on a surgical thermostator. Then the rats were subjected to an abdominal incision, and the right kidney was carefully liberated from surrounding tissue, and nephrectomy was performed. The left kidney was exposed after a midline incision, and the renal artery was clamped with non-traumatic clamps for 45 min, followed by restoring of the renal blood flow. The kidneys were harvested and the serum was collected 48 h after the surgery. The rats in sham group were subjected to an abdominal incision without clamping the renal artery.

    Click to Show/Hide
Response regulation MiR-182-5p and miR-378a-3p induced ferroptosis in cells. And miR-182-5p and miR-378a-3p regulated the expression of GPX4 and SLC7A11 negatively by directly binding to the 3'UTR of GPX4 and SLC7A11 mRNA. In vivo study showed that silencing miR-182-5p and miR-378a-3p alleviated the I/R-induced kidney injury in rats.
References
Ref 1 miR-182-5p and miR-378a-3p regulate ferroptosis in I/R-induced renal injury. Cell Death Dis. 2020 Oct 28;11(10):929. doi: 10.1038/s41419-020-03135-z.