General Information of the Ferroptosis Regulator (ID: REG20095)
Regulator Name mmu-miR-124-3p (miRNA)
Synonyms
mmu-miR-124-3p
    Click to Show/Hide
Gene Name mmu-miR-124-3p
Regulator Type miRNA
MiRBase ID MIMAT0000134
Sequence
UAAGGCACGCGGUGAAUGCC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-124-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Solute carrier family 40 member 1 (SLC40A1) [Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Intracerebral hemorrhage ICD-11: 8B00
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
HEK-293T cells Normal Homo sapiens CVCL_0063
hBCs (Brain cells)
In Vivo Model
Fpn-floxed (Fpnflox/flox) mice were obtained from Dr. N.C. Andrews and transferred into a C57bl/6 background. Mice were treated with a mixture of ketamine (100 mg/kg) and dexmedetomidine (0.5 mg/kg) and immobilized on a stereotaxic apparatus (RWD Life Science Co., Shenzhen). All experimental mice received a total of 20 ul autologous blood injected successively into the caudate nucleus (bregma 0: 0.8 mm anterior, 2 mm left lateral and 3.5 mm deep).

    Click to Show/Hide
Response regulation Both apoptosis and ferroptosis, but not necroptosis, were regulated by miR-124/Fpn signaling manipulation. Thus, Fpn upregulation or miR-124 inhibition might be promising therapeutic approachs for intracerebral hemorrhage (ICH).
Intracerebral hemorrhage [ICD-11: 8B00]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-124-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
HEK-293T cells Normal Homo sapiens CVCL_0063
hBCs (Brain cells)
In Vivo Model
Fpn-floxed (Fpnflox/flox) mice were obtained from Dr. N.C. Andrews and transferred into a C57bl/6 background. Mice were treated with a mixture of ketamine (100 mg/kg) and dexmedetomidine (0.5 mg/kg) and immobilized on a stereotaxic apparatus (RWD Life Science Co., Shenzhen). All experimental mice received a total of 20 ul autologous blood injected successively into the caudate nucleus (bregma 0: 0.8 mm anterior, 2 mm left lateral and 3.5 mm deep).

    Click to Show/Hide
Response regulation Both apoptosis and ferroptosis, but not necroptosis, were regulated by miR-124/Fpn signaling manipulation. Thus, Fpn upregulation or miR-124 inhibition might be promising therapeutic approachs for intracerebral hemorrhage (ICH).
References
Ref 1 Targeting miR-124/Ferroportin signaling ameliorated neuronal cell death through inhibiting apoptosis and ferroptosis in aged intracerebral hemorrhage murine model. Aging Cell. 2020 Nov;19(11):e13235. doi: 10.1111/acel.13235. Epub 2020 Oct 17.