General Information of the Ferroptosis Regulator (ID: REG20094)
Regulator Name hsa-miR-92 (miRNA)
Synonyms
hsa-miR-92
    Click to Show/Hide
Gene Name hsa-miR-92
Regulator Type miRNA
MiRBase ID MIMAT0003218
Sequence
UAUUGCACUCGUCCCGGCCUCC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-92 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Health ICD-11: N.A.
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
HUVECs (Human umbilical vein endothelial cells)
Response regulation The upregulated expression of individual miRNAs, miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92 were determined by qRT-PCR. This study revealed a novel mechanism through which miR-17-92 protects endothelial cells from erastin-induced ferroptosis by targeting the A20-ACSL4 axis.
Health [ICD-11: N.A.]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-92 (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
HUVECs (Human umbilical vein endothelial cells)
Response regulation The upregulated expression of individual miRNAs, miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92 were determined by qRT-PCR. This study revealed a novel mechanism through which miR-17-92 protects endothelial cells from erastin-induced ferroptosis by targeting the A20-ACSL4 axis.
References
Ref 1 miRNA-17-92 protects endothelial cells from erastin-induced ferroptosis through targeting the A20-ACSL4 axis. Biochem Biophys Res Commun. 2019 Jul 30;515(3):448-454. doi: 10.1016/j.bbrc.2019.05.147. Epub 2019 May 31.