General Information of the Ferroptosis Regulator (ID: REG20092)
Regulator Name mmu-miR-7a-5p (miRNA)
Synonyms
mmu-miR-7a-5p
    Click to Show/Hide
Gene Name mmu-miR-7a-5p
Regulator Type miRNA
MiRBase ID MIMAT0000677
Sequence
UGGAAGACUAGUGAUUUUGUUGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-7a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Responsed Drug Bromelain Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-7a-5p (miRNA) miRNA
Responsed Drug Bromelain Investigative
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
Bromelain [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Long-chain-fatty-acid--CoA ligase 4 (ACSL4) Driver
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H508 cells Cecum adenocarcinoma Homo sapiens CVCL_1564
HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
G13D (Human colorectal cancer cells)
DLD-1 cells Colon adenocarcinoma Homo sapiens CVCL_0248
G12D (Human colorectal cancer cells)
CCD-18Co cells Normal Homo sapiens CVCL_2379
In Vivo Model
Animals (n = 7) were given 2.5% DSS in drinking water for 5 days and then no treatment for 14 days as one cycle; this process was repeated for three cycles. In the last cycle, 2% DSS water treated to each group and no treatment for 14 days. During the three DSS cycle, 3 mg/kg bromelain were injected daily intraperitoneally and colon and spleen tissues were harvested after three DSS cycle in 57 days to study polyp burden and to perform histological staining.

    Click to Show/Hide
Response regulation Elevated miR-19b-3p, -130a-3p, -150-5p, -144-3p, -16-5p, -7a-5p, and -17-5p in bromelain-treated CaCO2cells compared to in DLD-1 cells potentially targeted ACSL-4 and resulted in suppression of ACSL-4. Overall, bromelain inhibits proliferation of Kras mutant Colorectal Cancer (CRC) effectively via ACSL-4.
References
Ref 1 Bromelain effectively suppresses Kras-mutant colorectal cancer by stimulating ferroptosis. Anim Cells Syst (Seoul). 2018 Aug 30;22(5):334-340. doi: 10.1080/19768354.2018.1512521. eCollection 2018.