Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20090)
Regulator Name mmu-miR-5627-5p (miRNA)
Synonyms
mmu-miR-5627-5p
    Click to Show/Hide
Gene Name mmu-miR-5627-5p
Regulator Type miRNA
MiRBase ID MIMAT0022385
Sequence
ACAGGGCUCUCCGGCGCCCCUCGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-5627-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Ferroptosis suppressor protein 1 (AIFM2) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Spinal cord injury ICD-11: ND51
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HT22 cells Normal Mus musculus CVCL_0321
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Male C57BL/6 (7-8 weeks) were purchased from the Animal Center of Nanjing University (Nanjing, China) and housed in the condition with controlled temperature and humidity under a 12-h light/dark circadian rhythm. For determining the effects of MSCs-exo, the animals were derived into three groups: sham (n = 10), ASCI (n = 10), ASCI + MSCs (n = 10); for determining the effects of exosomal lncGm36569, the animals were divided into five groups: sham (n = 10), ASCI (n = 10), ASCI + MSC-Exo (ctrl) (n = 10), ASCI + MSCs-Exo (lnc-OE) (n =10), ASCI + MSCs-Exo (si-lnc) (n = 10).

    Click to Show/Hide
Response regulation Exosomes derived from mesenchymal stem cells (MSCs) have been considered as an alternative for cell therapy of acute spinal cord injury (ASCI). MSCs-exosomes lncGm36569 inhibited neuronal cell ferroptosis through miR-5627-5p/FSP1 axis, thereby attenuating neuronal dysfunction.
Spinal cord injury [ICD-11: ND51]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-5627-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HT22 cells Normal Mus musculus CVCL_0321
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Male C57BL/6 (7-8 weeks) were purchased from the Animal Center of Nanjing University (Nanjing, China) and housed in the condition with controlled temperature and humidity under a 12-h light/dark circadian rhythm. For determining the effects of MSCs-exo, the animals were derived into three groups: sham (n = 10), ASCI (n = 10), ASCI + MSCs (n = 10); for determining the effects of exosomal lncGm36569, the animals were divided into five groups: sham (n = 10), ASCI (n = 10), ASCI + MSC-Exo (ctrl) (n = 10), ASCI + MSCs-Exo (lnc-OE) (n =10), ASCI + MSCs-Exo (si-lnc) (n = 10).

    Click to Show/Hide
Response regulation Exosomes derived from mesenchymal stem cells (MSCs) have been considered as an alternative for cell therapy of acute spinal cord injury (ASCI). MSCs-exosomes lncGm36569 inhibited neuronal cell ferroptosis through miR-5627-5p/FSP1 axis, thereby attenuating neuronal dysfunction.
References
Ref 1 Mesenchymal Stem Cell Derived Exosomes Suppress Neuronal Cell Ferroptosis Via lncGm36569/miR-5627-5p/FSP1 Axis in Acute Spinal Cord Injury. Stem Cell Rev Rep. 2022 Mar;18(3):1127-1142. doi: 10.1007/s12015-022-10327-x. Epub 2022 Mar 7.