General Information of the Ferroptosis Regulator (ID: REG20086)
Regulator Name hsa-miR-370-3p (miRNA)
Synonyms
hsa-miR-370-3p
    Click to Show/Hide
Gene Name hsa-miR-370-3p
Regulator Type miRNA
MiRBase ID MIMAT0000722
Sequence
GCCUGCUGGGGUGGAACCUGGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-370-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Transferrin receptor protein 1 (TFRC) [Driver; Suppressor; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor/Driver
Responsed Disease Periodontitis ICD-11: DA0C
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
hPLSCs (Periodontal ligament stem cells)
Response regulation Inhibition of LINC00616 promoted cell viability and suppressed ferroptosis of PDLSCs. miR-370 was verified to be a target of LINC00616. Additionally, miR-370 targeting the transferrin receptor protein and upregulated transferrin receptor (TFRC) abolished the effects of overexpressed miR-370 on cell viability and ferroptosis of PDLSCs. Therefore, LINC00616 knockdown may be a promising therapeutic strategy for periodontitis.
Periodontitis [ICD-11: DA0C]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-370-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
hPLSCs (Periodontal ligament stem cells)
Response regulation Inhibition of LINC00616 promoted cell viability and suppressed ferroptosis of PDLSCs. miR-370 was verified to be a target of LINC00616. Additionally, miR-370 targeting the transferrin receptor protein and upregulated transferrin receptor (TFRC) abolished the effects of overexpressed miR-370 on cell viability and ferroptosis of PDLSCs. Therefore, LINC00616 knockdown may be a promising therapeutic strategy for periodontitis.
References
Ref 1 Long non-coding RNA LINC00616 promotes ferroptosis of periodontal ligament stem cells via the microRNA-370 / transferrin receptor axis. Bioengineered. 2022 May;13(5):13070-13081. doi: 10.1080/21655979.2022.2076508.