Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20082)
Regulator Name hsa-miR-339-3p (miRNA)
Synonyms
hsa-miR-339-3p
    Click to Show/Hide
Gene Name hsa-miR-339-3p
Regulator Type miRNA
MiRBase ID MIMAT0004702
Sequence
UGAGCGCCUCGACGACAGAGCCG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-339-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
Cell proliferation
Cell metastasis
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
16HBE14o- cells Normal Homo sapiens CVCL_0112
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
In Vivo Model
6-8 weeks mice were divided into 4 groups randomly. Mice were injected with 2.5 x 105 wild type LLC cells, Uc.339 OE-LLC cells, with or without miR-339 inhibitors, respectively, through the lateral tail vain. The mice were killed after 4 weeks by carbon dioxide asphyxiation followed by cervical dislocation to ensure death. The lungs were removed, rinsed with PBS, and the number of metastatic foci on the lung surface was counted. The pulmonary lobes were subsequently kept in 4% paraformaldehyde for later paraffin embedding and hematoxylin and eosin staining.

    Click to Show/Hide
Response regulation LncRNA Uc.339 competitively binds to pri-miR-339 and inhibits the production of mature miR-339. At the same time, it is the first to clarify the reason for the negative correlation between miR-339 and SLC7A11 expression in lung cancer, and for the first verification that the inhibition of miR-339 led to increased expression of SLC7A11 and weakens ferroptosis, which constituted an important carcinogenesis mechanism for lung adenocarcinoma metastasis.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-339-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
Cell proliferation
Cell metastasis
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
16HBE14o- cells Normal Homo sapiens CVCL_0112
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
In Vivo Model
6-8 weeks mice were divided into 4 groups randomly. Mice were injected with 2.5 x 105 wild type LLC cells, Uc.339 OE-LLC cells, with or without miR-339 inhibitors, respectively, through the lateral tail vain. The mice were killed after 4 weeks by carbon dioxide asphyxiation followed by cervical dislocation to ensure death. The lungs were removed, rinsed with PBS, and the number of metastatic foci on the lung surface was counted. The pulmonary lobes were subsequently kept in 4% paraformaldehyde for later paraffin embedding and hematoxylin and eosin staining.

    Click to Show/Hide
Response regulation LncRNA Uc.339 competitively binds to pri-miR-339 and inhibits the production of mature miR-339. At the same time, it is the first to clarify the reason for the negative correlation between miR-339 and SLC7A11 expression in lung cancer, and for the first verification that the inhibition of miR-339 led to increased expression of SLC7A11 and weakens ferroptosis, which constituted an important carcinogenesis mechanism for lung adenocarcinoma metastasis.
References
Ref 1 LncRNA T-UCR Uc.339/miR-339/SLC7A11 Axis Regulates the Metastasis of Ferroptosis-Induced Lung Adenocarcinoma. J Cancer. 2022 Mar 28;13(6):1945-1957. doi: 10.7150/jca.65017. eCollection 2022.