General Information of the Ferroptosis Regulator (ID: REG20080)
Regulator Name mmu-miR-3098-3p (miRNA)
Synonyms
mmu-miR-3098-3p
    Click to Show/Hide
Gene Name mmu-miR-3098-3p
Gene ID 100526526
Regulator Type miRNA
MiRBase ID MIMAT0014918
Sequence
UCCUAACAGCAGGAGUAGGAGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-3098-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Cerebral ischaemic stroke ICD-11: 8B11
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT22 cells Normal Mus musculus CVCL_0321
Response regulation Circ-Carm1 was evidently abundant in acute cerebral infarction model cells, and knockdown of circ-Carm1 notably restored cell viability and inhibited ferroptosis in ACI model cells. Mechanistically, circ-Carm1 sponged miR-3098-3p to upregulate ACSL4 expression in ACI model cells to participate in ACI progressionin vitro.
Cerebral ischaemic stroke [ICD-11: 8B11]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-3098-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT22 cells Normal Mus musculus CVCL_0321
Response regulation Circ-Carm1 was evidently abundant in acute cerebral infarction model cells, and knockdown of circ-Carm1 notably restored cell viability and inhibited ferroptosis in ACI model cells. Mechanistically, circ-Carm1 sponged miR-3098-3p to upregulate ACSL4 expression in ACI model cells to participate in ACI progressionin vitro.
References
Ref 1 Depletion of mmu_circ_0001751 (circular RNA Carm1) protects against acute cerebral infarction injuries by binding with microRNA-3098-3p to regulate acyl-CoA synthetase long-chain family member 4. Bioengineered. 2022 Feb;13(2):4063-4075. doi: 10.1080/21655979.2022.2032971.