General Information of the Ferroptosis Regulator (ID: REG20079)
Regulator Name hsa-miR-205-3p (miRNA)
Synonyms
hsa-miR-205-3p
    Click to Show/Hide
Gene Name hsa-miR-205-3p
Regulator Type miRNA
MiRBase ID MIMAT0009197
Sequence
GAUUUCAGUGGAGUGAAGUUC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-205-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Ischemia/reperfusion injury ICD-11: DB98
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Adult male Sprague Dawley rats (3 months old, 200 g) purchased from the Animal Center of Nanjing University were housed at a controlled temperature of 18-22 and humidity of 50-70% under a 12-h light/dark cycle with free access to food and water. Before the operation, the rats were fasted overnight with free access to water. At the beginning of the operation, the rats were intraperitoneally injected with chloral hydrate (0.5 ml/100 g) for sedation) and 5% additional first dose for unsatisfactory sedation and made to inhale isoflurane for anesthesia. After incising the skin, the muscle was carefully separated layer by layer, and the trachea was exposed and fixed locally with a self-made pull hook. The trachea was then cut with a 10 ml syringe needle. The anesthesia mask was then replaced with the tracheal intubation. The ventilator was connected to the anesthesia machine for isopentane inhalation (2%). The proximal left anterior descending artery (LAD) was ligated using a 6.0 Prolene suture to induce myocardial ischemia. A small semi-cylindrical plastic hose was inserted to the LAD to facilitate the opening of the knot during reperfusion and to reduce the mechanical damage to the heart tissue and blood vessels. About 5 min later, the chest cavity was temporarily closed with a non-damaging hemostatic clip. After 30 min of ischemia, the noninjury hemostatic clip was loosened, the ligation and the protective tube were removed for reperfusion, and the chest was closed. The rats in the sham group underwent the same operation without being subjected to MI/R.

    Click to Show/Hide
Response regulation LncAABR07025387.1 acts as a competing endogenous RNA during myocardial ischemia/reperfusion injury. Mechanistically, lncAABR07025387.1 negatively regulates miR-205 expression and subsequently upregulates ACSL4-mediated ferroptosis.
Ischemia/reperfusion injury [ICD-11: DB98]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-205-3p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
HEK-293T cells Normal Homo sapiens CVCL_0063
In Vivo Model
Adult male Sprague Dawley rats (3 months old, 200 g) purchased from the Animal Center of Nanjing University were housed at a controlled temperature of 18-22 and humidity of 50-70% under a 12-h light/dark cycle with free access to food and water. Before the operation, the rats were fasted overnight with free access to water. At the beginning of the operation, the rats were intraperitoneally injected with chloral hydrate (0.5 ml/100 g) for sedation) and 5% additional first dose for unsatisfactory sedation and made to inhale isoflurane for anesthesia. After incising the skin, the muscle was carefully separated layer by layer, and the trachea was exposed and fixed locally with a self-made pull hook. The trachea was then cut with a 10 ml syringe needle. The anesthesia mask was then replaced with the tracheal intubation. The ventilator was connected to the anesthesia machine for isopentane inhalation (2%). The proximal left anterior descending artery (LAD) was ligated using a 6.0 Prolene suture to induce myocardial ischemia. A small semi-cylindrical plastic hose was inserted to the LAD to facilitate the opening of the knot during reperfusion and to reduce the mechanical damage to the heart tissue and blood vessels. About 5 min later, the chest cavity was temporarily closed with a non-damaging hemostatic clip. After 30 min of ischemia, the noninjury hemostatic clip was loosened, the ligation and the protective tube were removed for reperfusion, and the chest was closed. The rats in the sham group underwent the same operation without being subjected to MI/R.

    Click to Show/Hide
Response regulation LncAABR07025387.1 acts as a competing endogenous RNA during myocardial ischemia/reperfusion injury. Mechanistically, lncAABR07025387.1 negatively regulates miR-205 expression and subsequently upregulates ACSL4-mediated ferroptosis.
References
Ref 1 LncAABR07025387.1 Enhances Myocardial Ischemia/Reperfusion Injury Via miR-205/ACSL4-Mediated Ferroptosis. Front Cell Dev Biol. 2022 Feb 2;10:672391. doi: 10.3389/fcell.2022.672391. eCollection 2022.