General Information of the Ferroptosis Regulator (ID: REG20076)
Regulator Name hsa-miR-1228-3p (miRNA)
Synonyms
hsa-miR-1228-3p
    Click to Show/Hide
Gene Name hsa-miR-1228-3p
Regulator Type miRNA
MiRBase ID MIMAT0005583
Sequence
UCACACCUGCCUCGCCCCCC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-1228-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Ferroptosis suppressor protein 1 (AIFM2) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Breast cancer ICD-11: 2C60
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell infiltration
Cell migration
In Vitro Model
SK-BR-3 cells Breast adenocarcinoma Homo sapiens CVCL_0033
BT-474 cells Invasive breast carcinoma Homo sapiens CVCL_0179
In Vivo Model
Female BALB/c nude mice aged 4 weeks were administered subcutaneously with 2 x 106 cells (five mice/group). After that, the mice were given intratumoural inoculation of 40 uL si-circGFRA1 or si-NC every 4 days. To detect lung metastases, we intravenously inoculated 1 x 105 cells into the tail veins of mice (six mice/group). After the elapse of 8 weeks, we anaesthetized the mice, harvested their lungs and visually counted the metastatic nodules in the lungs, followed by validation via H&E staining and counting under a microscope.

    Click to Show/Hide
Response regulation Knockdown of circGFRA1 could attenuate HER-2-positive HER-2-positive breast cancer progression by inhibiting the proliferation, infiltration and migratory ability of HER-2-positive BC cells. Through ceRNA mechanism, circGFRA1 could bind to miR-1228 and alleviate inhibitory activity of miR-1228 on targeted gene AIFM2.
Breast cancer [ICD-11: 2C60]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-1228-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell infiltration
Cell migration
In Vitro Model
SK-BR-3 cells Breast adenocarcinoma Homo sapiens CVCL_0033
BT-474 cells Invasive breast carcinoma Homo sapiens CVCL_0179
In Vivo Model
Female BALB/c nude mice aged 4 weeks were administered subcutaneously with 2 x 106 cells (five mice/group). After that, the mice were given intratumoural inoculation of 40 uL si-circGFRA1 or si-NC every 4 days. To detect lung metastases, we intravenously inoculated 1 x 105 cells into the tail veins of mice (six mice/group). After the elapse of 8 weeks, we anaesthetized the mice, harvested their lungs and visually counted the metastatic nodules in the lungs, followed by validation via H&E staining and counting under a microscope.

    Click to Show/Hide
Response regulation Knockdown of circGFRA1 could attenuate HER-2-positive HER-2-positive breast cancer progression by inhibiting the proliferation, infiltration and migratory ability of HER-2-positive BC cells. Through ceRNA mechanism, circGFRA1 could bind to miR-1228 and alleviate inhibitory activity of miR-1228 on targeted gene AIFM2.
References
Ref 1 CircGFRA1 facilitates the malignant progression of HER-2-positive breast cancer via acting as a sponge of miR-1228 and enhancing AIFM2 expression. J Cell Mol Med. 2021 Nov;25(21):10248-10256. doi: 10.1111/jcmm.16963. Epub 2021 Oct 20.