Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20075)
Regulator Name gga-miR-129-3p (miRNA)
Synonyms
gga-miR-129-3p
    Click to Show/Hide
Gene Name gga-miR-129-3p
Regulator Type miRNA
MiRBase ID MIMAT0050082
Sequence
AAGCCCUUACCCCAAAAAGGAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
gga-miR-129-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Injury of intra-abdominal organs ICD-11: NB91
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 LMH cells Hepatoma Gallus gallus CVCL_2580
LMH cells Hepatoma Gallus gallus CVCL_2580
Response regulation miR-129-3p affected ferroptosis under Se deficiency conditions through the SLC7A11 pathway. Our research provides a new perspective for the mechanism of Se deficiency on the liver damage.
Injury of intra-abdominal organs [ICD-11: NB91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator gga-miR-129-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 LMH cells Hepatoma Gallus gallus CVCL_2580
LMH cells Hepatoma Gallus gallus CVCL_2580
Response regulation miR-129-3p affected ferroptosis under Se deficiency conditions through the SLC7A11 pathway. Our research provides a new perspective for the mechanism of Se deficiency on the liver damage.
References
Ref 1 MiR-129-3p regulates ferroptosis in the liver of Selenium-deficient broilers by targeting SLC7A11. Poult Sci. 2023 Jan;102(1):102271. doi: 10.1016/j.psj.2022.102271. Epub 2022 Oct 27.