General Information of the Ferroptosis Regulator (ID: REG20073)
Regulator Name hsa-miR-520a-5p (miRNA)
Synonyms
hsa-miR-520a-5p
    Click to Show/Hide
Gene Name hsa-miR-520a-5p
Regulator Type miRNA
MiRBase ID MIMAT0002833
Sequence
CUCCAGAGGGAAGUACUUUCU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-520a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT29 cells Colon cancer Mus musculus CVCL_A8EZ
In Vivo Model
SCID/nude mice (6 weeks old) were ordered from Laboratory Animal Center of Chinese Academy of Sciences (Beijing, China). HT29 cells were co-transfected with sh-circFOXP1 and pCMV-SLC7A11 or empty vector. Cells were digested, 5 x 106 cells were mixed with Matrigel (Corning) and subcutaneously injected into mice. The width and length of tumor were measured at indicated time, and the tumor size was calculated by the formula: 0.5 x length x width2. Mice were then succumbed to death, the tumors were isolated, weighted, and made into paraffin-embedded slices (5-um). The slices were stained with anti-KI67 antibody (Santa Cruz Biotechnology) and subsequent HRP-labeled secondary antibody and captured in a microscope (Leica Microsystems).

    Click to Show/Hide
Response regulation Mechanically, circFOXP1 increased SLC7A11 expression by directly sponging miR-520a-5p in lung cancer cells. The inhibitor of miR-520a-5p or the overexpression of SLC7A11 reversed circFOXP1 shRNA-induced ferroptosis phenotypes in lung cancer cells.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-520a-5p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT29 cells Colon cancer Mus musculus CVCL_A8EZ
In Vivo Model
SCID/nude mice (6 weeks old) were ordered from Laboratory Animal Center of Chinese Academy of Sciences (Beijing, China). HT29 cells were co-transfected with sh-circFOXP1 and pCMV-SLC7A11 or empty vector. Cells were digested, 5 x 106 cells were mixed with Matrigel (Corning) and subcutaneously injected into mice. The width and length of tumor were measured at indicated time, and the tumor size was calculated by the formula: 0.5 x length x width2. Mice were then succumbed to death, the tumors were isolated, weighted, and made into paraffin-embedded slices (5-um). The slices were stained with anti-KI67 antibody (Santa Cruz Biotechnology) and subsequent HRP-labeled secondary antibody and captured in a microscope (Leica Microsystems).

    Click to Show/Hide
Response regulation Mechanically, circFOXP1 increased SLC7A11 expression by directly sponging miR-520a-5p in lung cancer cells. The inhibitor of miR-520a-5p or the overexpression of SLC7A11 reversed circFOXP1 shRNA-induced ferroptosis phenotypes in lung cancer cells.
References
Ref 1 Potential of Curcumin and Quercetin in Modulation of Premature Mitochondrial Senescence and Related Changes during Lung Carcinogenesis. J Environ Pathol Toxicol Oncol. 2021;40(4):53-60. doi: 10.1615/JEnvironPatholToxicolOncol.2021039371.