Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20069)
Regulator Name hsa-miR-206 (miRNA)
Synonyms
hsa-miR-206
    Click to Show/Hide
Gene Name hsa-miR-206
Regulator Type miRNA
MiRBase ID MIMAT0000462
Sequence
UGGAAUGUAAGGAAGUGUGUGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-206 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Cystine/glutamate transporter (SLC7A11) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Osteosarcoma ICD-11: 2B51
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 SJSA-1 cells Osteosarcoma Homo sapiens CVCL_1697
Response regulation LncRNA SNHG14 targeted and down-regulated the expression of miR-206, further affecting the common ferroptosis inhibitor SLC7A11, and preventing NR-SJSA1 cells from undergoing ferroptosis. In conclusion, our findings highlight the involvement of lncRNA SNHG14 in ferroptosis and chemotherapy resistance of nutlin3a-resistant NR-SJSA1 cells, thus shedding new insight on how to overcome drug resistance in osteosarcoma cells and improve treatment efficacy.
Osteosarcoma [ICD-11: 2B51]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-206 (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 SJSA-1 cells Osteosarcoma Homo sapiens CVCL_1697
Response regulation LncRNA SNHG14 targeted and down-regulated the expression of miR-206, further affecting the common ferroptosis inhibitor SLC7A11, and preventing NR-SJSA1 cells from undergoing ferroptosis. In conclusion, our findings highlight the involvement of lncRNA SNHG14 in ferroptosis and chemotherapy resistance of nutlin3a-resistant NR-SJSA1 cells, thus shedding new insight on how to overcome drug resistance in osteosarcoma cells and improve treatment efficacy.
References
Ref 1 LncSNHG14 promotes nutlin3a resistance by inhibiting ferroptosis via the miR-206 /SLC7A11 axis in osteosarcoma cells. Cancer Gene Ther. 2023 May;30(5):704-715. doi: 10.1038/s41417-022-00581-z. Epub 2023 Jan 4.