Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20064)
Regulator Name hsa-miR-670-3p (miRNA)
Synonyms
hsa-miR-670-3p
    Click to Show/Hide
Gene Name hsa-miR-670-3p
Regulator Type miRNA
MiRBase ID MIMAT0026640
Sequence
UUUCCUCAUAUUCAUUCAGGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-670-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Long-chain-fatty-acid--CoA ligase 4 (ACSL4) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Glioblastoma ICD-11: 2A00
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 U-87MG cells Glioblastoma Homo sapiens CVCL_GP63
A-172 cells Glioblastoma Homo sapiens CVCL_0131
SVG p12 cells Normal Homo sapiens CVCL_3797
hMGCs (Human normal brain astroglia cells)
Response regulation miR-670-3p level was elevated in human glioblastoma, but decreased upon ferroptotic stimulation. Mechanistically, ACSL4 was required for the regulation on ferroptosis and growth of glioblastoma cells by miR-670-3p. Moreover, U87MG and A172 cells treated with miR-670-3p inhibitor showed an increased chemosensitivity to TMZ.
Glioblastoma [ICD-11: 2A00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-670-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 U-87MG cells Glioblastoma Homo sapiens CVCL_GP63
A-172 cells Glioblastoma Homo sapiens CVCL_0131
SVG p12 cells Normal Homo sapiens CVCL_3797
hMGCs (Human normal brain astroglia cells)
Response regulation miR-670-3p level was elevated in human glioblastoma, but decreased upon ferroptotic stimulation. Mechanistically, ACSL4 was required for the regulation on ferroptosis and growth of glioblastoma cells by miR-670-3p. Moreover, U87MG and A172 cells treated with miR-670-3p inhibitor showed an increased chemosensitivity to TMZ.
References
Ref 1 MicroRNA-670-3p suppresses ferroptosis of human glioblastoma cells through targeting ACSL4. Free Radic Res. 2021 Jul;55(7):853-864. doi: 10.1080/10715762.2021.1962009. Epub 2021 Aug 9.