General Information of the Ferroptosis Regulator (ID: REG20062)
Regulator Name hsa-miR-212-5p (miRNA)
Synonyms
hsa-miR-212-5p
    Click to Show/Hide
Gene Name hsa-miR-212-5p
Regulator Type miRNA
MiRBase ID MIMAT0022695
Sequence
ACCUUGGCUCUAGACUGCUUACU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-212-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Prostaglandin G/H synthase 2 (PTGS2) [Driver; Marker]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker
Responsed Disease Traumatic brain injury ICD-11: NA07
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT22 cells Normal Mus musculus CVCL_0321
Neuro-2a cells Neuroblastoma Mus musculus CVCL_0470
In Vivo Model
Adult male C57BL/6J mice, aged 10-12 weeks and weighing 20 to 24 g. Briefly, following anesthesia with isoflurane (4% for induction and 12% for maintenance), mice were mounted on a stereotaxic frame. A midsagittal incision was performed in the scalp under sterile conditions and a 4.5 mm diameter circular craniotomy was made over the left parietotemporal cortex with a burr drill. Then, the skullcap was gently removed and a 3.0 mm diameter round and flat tip was carefully placed vertically to the dural surface. The electromagnetic controlled cortical impact device was set to 5.0 m/s for strike velocity, 2.0 mm for strike depth and 100 ms for dwell time. A sterile plastic film covered the bone window and intermittent sutures of the skin, and disinfection with iodophor were performed. The entire procedure required 15-30 min per mouse.

    Click to Show/Hide
Response regulation Ferroptosis, a newly discovered form of iron-dependent regulated cell death, has been implicated in traumatic brain injury (TBI). Overexpression of miR-212-5p attenuated ferroptosis while downregulation of miR-212-5p promoted ferroptotic cell death partially by targeting prostaglandin-endoperoxide synthase-2 (Ptgs2) in HT-22 and Neuro-2a cell lines.
Traumatic brain injury [ICD-11: NA07]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-212-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
HT22 cells Normal Mus musculus CVCL_0321
Neuro-2a cells Neuroblastoma Mus musculus CVCL_0470
In Vivo Model
Adult male C57BL/6J mice, aged 10-12 weeks and weighing 20 to 24 g. Briefly, following anesthesia with isoflurane (4% for induction and 12% for maintenance), mice were mounted on a stereotaxic frame. A midsagittal incision was performed in the scalp under sterile conditions and a 4.5 mm diameter circular craniotomy was made over the left parietotemporal cortex with a burr drill. Then, the skullcap was gently removed and a 3.0 mm diameter round and flat tip was carefully placed vertically to the dural surface. The electromagnetic controlled cortical impact device was set to 5.0 m/s for strike velocity, 2.0 mm for strike depth and 100 ms for dwell time. A sterile plastic film covered the bone window and intermittent sutures of the skin, and disinfection with iodophor were performed. The entire procedure required 15-30 min per mouse.

    Click to Show/Hide
Response regulation Ferroptosis, a newly discovered form of iron-dependent regulated cell death, has been implicated in traumatic brain injury (TBI). Overexpression of miR-212-5p attenuated ferroptosis while downregulation of miR-212-5p promoted ferroptotic cell death partially by targeting prostaglandin-endoperoxide synthase-2 (Ptgs2) in HT-22 and Neuro-2a cell lines.
References
Ref 1 miR-212-5p attenuates ferroptotic neuronal death after traumatic brain injury by targeting Ptgs2. Mol Brain. 2019 Sep 18;12(1):78. doi: 10.1186/s13041-019-0501-0.