Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20059)
Regulator Name hsa-miR-4715-3p (miRNA)
Synonyms
hsa-miR-4715-3p
    Click to Show/Hide
Gene Name hsa-miR-4715-3p
Regulator Type miRNA
MiRBase ID MIMAT0019825
Sequence
GUGCCACCUUAACUGCAGCCAAU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-4715-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Gastrointestinal cancer ICD-11: 2B5B
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 OE33 cells Barrett adenocarcinoma Homo sapiens CVCL_0471
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
STKM-2 cells Gastric carcinoma Homo sapiens CVCL_M570
Response regulation Upper gastrointestinal adenocarcinoma (UGC) tissue samples and cell models demonstrated significant overexpression of AURKA with downregulation of miR-4715-3p. Inhibition of AURKA or reconstitution of miR-4715-3p inhibited GPX4 and induced cell death, suggesting a link between AURKA and ferroptosis.
Gastrointestinal cancer [ICD-11: 2B5B]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-4715-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 OE33 cells Barrett adenocarcinoma Homo sapiens CVCL_0471
MKN45 cells Gastric adenocarcinoma Homo sapiens CVCL_0434
STKM-2 cells Gastric carcinoma Homo sapiens CVCL_M570
Response regulation Upper gastrointestinal adenocarcinoma (UGC) tissue samples and cell models demonstrated significant overexpression of AURKA with downregulation of miR-4715-3p. Inhibition of AURKA or reconstitution of miR-4715-3p inhibited GPX4 and induced cell death, suggesting a link between AURKA and ferroptosis.
References
Ref 1 Epigenetic regulation of AURKA by miR-4715-3p in upper gastrointestinal cancers. Sci Rep. 2019 Nov 18;9(1):16970. doi: 10.1038/s41598-019-53174-6.