Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20053)
Regulator Name hsa-miR-1287-5p (miRNA)
Synonyms
hsa-miR-1287-5p
    Click to Show/Hide
Gene Name hsa-miR-1287-5p
Regulator Type miRNA
MiRBase ID MIMAT0005878
Sequence
UGCUGGAUCAGUGGUUCGAGUC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-1287-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 2 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Osteosarcoma ICD-11: 2B51
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 hFOB 1.19 cells Normal Homo sapiens CVCL_3708
SAOS-2 cells Osteosarcoma Homo sapiens CVCL_0548
U2OS cells Osteosarcoma Homo sapiens CVCL_0042
Response regulation MiR-1287-5p directly bound to the 3'-untranslated region of glutathione peroxidase 4 (GPX4) to inhibit its protein level and activity, and that GPX4 overexpression completely abolished the miR-1287-5p mimic-mediated ferroptotic induction and tumor suppression. The findings prove that miR-1287-5p promotes ferroptosis of osteosarcoma cells through inhibiting GPX4.
Experiment 2 Reporting the Ferroptosis Target of This Regulator [2]
Target for Ferroptosis Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 BEAS-2B cells Normal Homo sapiens CVCL_0168
NCI-H23 cells Lung adenocarcinoma Homo sapiens CVCL_1547
NCI-H522 cells Non-small cell lung carcinoma Homo sapiens CVCL_1567
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
In Vivo Model
The Shanghai SLAC Animal Center (Shanghai, China) provided 4-6-week-old BALB/c male nude mice, which were kept according to the standards for the use and care of laboratory animals. A total of 1 x 107 NSCLC cells infected with shRNA were injected subcutaneously into the left flank of nude mice (3 per group). Every 3 days, the tumor volume was measured.

    Click to Show/Hide
Response regulation It was identified that circDTL exerts its oncogenic effects via the circDTL/miR-1287-5p/GPX4 axis and GPX4 inhibits both ferroptosis and apoptosis. Finally, silencing of circDTL promoted the sensitivity of non-small cell lung cancer cells to chemotherapeutic agents and inhibited the growth of tumors in vivo.
Osteosarcoma [ICD-11: 2B51]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-1287-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 hFOB 1.19 cells Normal Homo sapiens CVCL_3708
SAOS-2 cells Osteosarcoma Homo sapiens CVCL_0548
U2OS cells Osteosarcoma Homo sapiens CVCL_0042
Response regulation MiR-1287-5p directly bound to the 3'-untranslated region of glutathione peroxidase 4 (GPX4) to inhibit its protein level and activity, and that GPX4 overexpression completely abolished the miR-1287-5p mimic-mediated ferroptotic induction and tumor suppression. The findings prove that miR-1287-5p promotes ferroptosis of osteosarcoma cells through inhibiting GPX4.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-1287-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 BEAS-2B cells Normal Homo sapiens CVCL_0168
NCI-H23 cells Lung adenocarcinoma Homo sapiens CVCL_1547
NCI-H522 cells Non-small cell lung carcinoma Homo sapiens CVCL_1567
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
In Vivo Model
The Shanghai SLAC Animal Center (Shanghai, China) provided 4-6-week-old BALB/c male nude mice, which were kept according to the standards for the use and care of laboratory animals. A total of 1 x 107 NSCLC cells infected with shRNA were injected subcutaneously into the left flank of nude mice (3 per group). Every 3 days, the tumor volume was measured.

    Click to Show/Hide
Response regulation It was identified that circDTL exerts its oncogenic effects via the circDTL/miR-1287-5p/GPX4 axis and GPX4 inhibits both ferroptosis and apoptosis. Finally, silencing of circDTL promoted the sensitivity of non-small cell lung cancer cells to chemotherapeutic agents and inhibited the growth of tumors in vivo.
References
Ref 1 MicroRNA-1287-5p promotes ferroptosis of osteosarcoma cells through inhibiting GPX4. Free Radic Res. 2021 Dec;55(11-12):1119-1129. doi: 10.1080/10715762.2021.2024816. Epub 2022 Jan 17.
Ref 2 CircDTL Functions as an Oncogene and Regulates Both Apoptosis and Ferroptosis in Non-small Cell Lung Cancer Cells. Front Genet. 2021 Sep 21;12:743505. doi: 10.3389/fgene.2021.743505. eCollection 2021.