Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20050)
Regulator Name hsa-miR-135b-3p (miRNA)
Synonyms
hsa-miR-135b-3p
    Click to Show/Hide
Gene Name hsa-miR-135b-3p
Regulator Type miRNA
MiRBase ID MIMAT0004698
Sequence
AUGUAGGGCUAAAAGCCAUGGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-135b-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Ischemia/reperfusion injury ICD-11: DB98
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Male Sprague-Dawley rats aged 8-10 weeks and weighing 220 g were obtained from the Nanjing Biomedical Research Institute of Nanjing University. Following acclimatization for 1 week, the rats were divided into five groups of six rats each before the experiment. The establishment of the myocardial I/R model was based on previous studies . Sodium pentobarbital (45 mg/kg, i.p.) was used to anesthetize the rats, and the left coronary artery (LCA) was exposed using left thoracotomy at the fifth intercostal space. Following the LCA ligation with 7-0 silk sutures, a smooth catheter was applied to the artery to achieve ischemia for 30 min. The rats were then sacrificed 120 min after reperfusion. Rats in the sham group (without the LCA I/R) underwent surgery and were treated with saline. The miR-135b-3p group rats were injected with miR-135b-3p overexpression virus or knockdown lentivirus (1 x 108 U/ml, 0.2 ml), respectively, for five consecutive days before surgery.

    Click to Show/Hide
Response regulation MiR-135b-3p was found to promote the myocardial I/R injury by downregulating GPX4 expression. The results of this study elucidate a novel function of miR-135b-3p in exacerbating cardiomyocyte ferroptosis, providing a new therapeutic target for improving myocardial ischemia/reperfusion injury.
Ischemia/reperfusion injury [ICD-11: DB98]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-135b-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
In Vitro Model
 CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
In Vivo Model
Male Sprague-Dawley rats aged 8-10 weeks and weighing 220 g were obtained from the Nanjing Biomedical Research Institute of Nanjing University. Following acclimatization for 1 week, the rats were divided into five groups of six rats each before the experiment. The establishment of the myocardial I/R model was based on previous studies . Sodium pentobarbital (45 mg/kg, i.p.) was used to anesthetize the rats, and the left coronary artery (LCA) was exposed using left thoracotomy at the fifth intercostal space. Following the LCA ligation with 7-0 silk sutures, a smooth catheter was applied to the artery to achieve ischemia for 30 min. The rats were then sacrificed 120 min after reperfusion. Rats in the sham group (without the LCA I/R) underwent surgery and were treated with saline. The miR-135b-3p group rats were injected with miR-135b-3p overexpression virus or knockdown lentivirus (1 x 108 U/ml, 0.2 ml), respectively, for five consecutive days before surgery.

    Click to Show/Hide
Response regulation MiR-135b-3p was found to promote the myocardial I/R injury by downregulating GPX4 expression. The results of this study elucidate a novel function of miR-135b-3p in exacerbating cardiomyocyte ferroptosis, providing a new therapeutic target for improving myocardial ischemia/reperfusion injury.
References
Ref 1 miR-135b-3p Promotes Cardiomyocyte Ferroptosis by Targeting GPX4 and Aggravates Myocardial Ischemia/Reperfusion Injury. Front Cardiovasc Med. 2021 Aug 13;8:663832. doi: 10.3389/fcvm.2021.663832. eCollection 2021.