Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20044)
Regulator Name hsa-miR-15a-3p (miRNA)
Synonyms
hsa-miR-15a-3p
    Click to Show/Hide
Gene Name hsa-miR-15a-3p
Regulator Type miRNA
MiRBase ID MIMAT0004488
Sequence
CAGGCCAUAUUGUGCUGCCUCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-15a-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
Caco-2 cells Colon adenocarcinoma Homo sapiens CVCL_0025
HT29 cells Colon cancer Mus musculus CVCL_A8EZ
KM12 cells Colon carcinoma Homo sapiens CVCL_1331
NCM460 cells Normal Homo sapiens CVCL_0460
In Vivo Model
We obtained the 6-week-old nude mice (BALB/c) from Beijing HFK Bioscience Co., Ltd. and randomly divided into eight groups (n = 5/group): (a) NC + dimethyl sulfoxide (DMSO) group; (b) NC + erastin group; (c) mimic + DMSO group; (d) mimic + erastin group; (e) iNC + DMSO group; (f) iNC + erastin group; (g) inhibitor + DMSO group; (h) inhibitor + erastin group. Control and transfected cells (7 x 106) were subcutaneously injected into the nude mice. After the tumor sizes reached roughly >50 mm3, mice in Groups B, D, F, and H were treated with 15 mg/kg erastin twice every day for about 20 days. Meanwhile, mice in Groups A, C, E, and G were treated with an equal volume DMSO. Besides, tumor formation and mass were monitored and the size of tumor was counted using the formula V = 0.5 x L x W2 (L, length and W, width). At last, after killing the nude mice and then we isolated the mice tumor tissues.

    Click to Show/Hide
Response regulation Overexpression of miR-15a-3p repressed GPX4 through binding to the 3'-untranslated region of GPX4, resulting in increased reactive oxygen species level, intracellular Fe2+ level, and malondialdehyde accumulation in vitro and in vivo. MiR-15a-3p suppressed colorectal cancer cell growth and enhanced cell ferroptosis by inactivating GPX4.
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-15a-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
Caco-2 cells Colon adenocarcinoma Homo sapiens CVCL_0025
HT29 cells Colon cancer Mus musculus CVCL_A8EZ
KM12 cells Colon carcinoma Homo sapiens CVCL_1331
NCM460 cells Normal Homo sapiens CVCL_0460
In Vivo Model
We obtained the 6-week-old nude mice (BALB/c) from Beijing HFK Bioscience Co., Ltd. and randomly divided into eight groups (n = 5/group): (a) NC + dimethyl sulfoxide (DMSO) group; (b) NC + erastin group; (c) mimic + DMSO group; (d) mimic + erastin group; (e) iNC + DMSO group; (f) iNC + erastin group; (g) inhibitor + DMSO group; (h) inhibitor + erastin group. Control and transfected cells (7 x 106) were subcutaneously injected into the nude mice. After the tumor sizes reached roughly >50 mm3, mice in Groups B, D, F, and H were treated with 15 mg/kg erastin twice every day for about 20 days. Meanwhile, mice in Groups A, C, E, and G were treated with an equal volume DMSO. Besides, tumor formation and mass were monitored and the size of tumor was counted using the formula V = 0.5 x L x W2 (L, length and W, width). At last, after killing the nude mice and then we isolated the mice tumor tissues.

    Click to Show/Hide
Response regulation Overexpression of miR-15a-3p repressed GPX4 through binding to the 3'-untranslated region of GPX4, resulting in increased reactive oxygen species level, intracellular Fe2+ level, and malondialdehyde accumulation in vitro and in vivo. MiR-15a-3p suppressed colorectal cancer cell growth and enhanced cell ferroptosis by inactivating GPX4.
References
Ref 1 MiR-15a-3p regulates ferroptosis via targeting glutathione peroxidase GPX4 in colorectal cancer. Mol Carcinog. 2022 Mar;61(3):301-310. doi: 10.1002/mc.23367. Epub 2021 Nov 2.