Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20032)
Regulator Name hsa-miR-302a-3p (miRNA)
Synonyms
hsa-miR-302a-3p
    Click to Show/Hide
Gene Name hsa-miR-302a-3p
Regulator Type miRNA
MiRBase ID MIMAT0000684
Sequence
UAAGUGCUUCCAUGUUUUGGUGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-302a-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Solute carrier family 40 member 1 (SLC40A1) [Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H358 cells Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1559
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
H1650-ER1 cells Minimally invasive lung adenocarcinoma Homo sapiens CVCL_4V01
BEAS-2B cells Normal Homo sapiens CVCL_0168
HBE1 cells Normal Homo sapiens CVCL_0287
Response regulation The miR-302a-3p mimic directly bound to the 3-UTR of FPN and decreased its protein expression, thereby causing intracellular iron overload and ferroptotic cell death, while the miR-302a-3p inhibitor significantly prevented erastin/RSL3-induced ferroptosis and tumor suppression. miR-302a-3p functions as a tumor inhibitor, via targeting ferroportin to induce ferroptosis of non-small cell lung cancer.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-302a-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H358 cells Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1559
NCI-H1299 cells Lung large cell carcinoma Homo sapiens CVCL_0060
H1650-ER1 cells Minimally invasive lung adenocarcinoma Homo sapiens CVCL_4V01
BEAS-2B cells Normal Homo sapiens CVCL_0168
HBE1 cells Normal Homo sapiens CVCL_0287
Response regulation The miR-302a-3p mimic directly bound to the 3-UTR of FPN and decreased its protein expression, thereby causing intracellular iron overload and ferroptotic cell death, while the miR-302a-3p inhibitor significantly prevented erastin/RSL3-induced ferroptosis and tumor suppression. miR-302a-3p functions as a tumor inhibitor, via targeting ferroportin to induce ferroptosis of non-small cell lung cancer.
References
Ref 1 MicroRNA-302a-3p induces ferroptosis of non-small cell lung cancer cells via targeting ferroportin. Free Radic Res. 2021 Jul;55(7):821-830. doi: 10.1080/10715762.2021.1947503. Epub 2021 Aug 6.