Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20030)
Regulator Name hsa-miR-190a-5p (miRNA)
Synonyms
hsa-miR-190a-5p
    Click to Show/Hide
Gene Name hsa-miR-190a-5p
Regulator Type miRNA
MiRBase ID MIMAT0000458
Sequence
UGAUAUGUUUGAUAUAUUAGGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-190a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Glutaminase liver isoform, mitochondrial (GLS2) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Acute myocardial infarction ICD-11: BA41
 Disease Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
HEK-293T cells Normal Homo sapiens CVCL_0063
Response regulation MiR-190a-5p negatively regulate ferroptosis via directly targeting GLS2 in rat cardiomyocyte H9c2 cells. Forced expression of miR-190a-5p inhibited GLS2, resulting in downregulation of ROS, MDA and Fe2+accumulation. In summary, miR-190a-5p plays an essential role in regulation of ferroptosis of cardiomyocytes and suggest a potential therapeutic target for myocardial infarction.
Acute myocardial infarction [ICD-11: BA41]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-190a-5p (miRNA) miRNA
 Regulator Info 
Pathway Response Glutathione metabolism hsa00480
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 CHO-S/H9C2 cells Normal Cricetulus griseus CVCL_A0TS
HEK-293T cells Normal Homo sapiens CVCL_0063
Response regulation MiR-190a-5p negatively regulate ferroptosis via directly targeting GLS2 in rat cardiomyocyte H9c2 cells. Forced expression of miR-190a-5p inhibited GLS2, resulting in downregulation of ROS, MDA and Fe2+accumulation. In summary, miR-190a-5p plays an essential role in regulation of ferroptosis of cardiomyocytes and suggest a potential therapeutic target for myocardial infarction.
References
Ref 1 miR-190a-5p regulates cardiomyocytes response to ferroptosis via directly targeting GLS2. Biochem Biophys Res Commun. 2021 Aug 20;566:9-15. doi: 10.1016/j.bbrc.2021.05.100. Epub 2021 Jun 7.