Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20023)
Regulator Name hsa-miR-137-3p (miRNA)
Synonyms
hsa-miR-137-3p
    Click to Show/Hide
Gene Name hsa-miR-137-3p
Regulator Type miRNA
MiRBase ID MIMAT0000429
Sequence
UUAUUGCUUAAGAAUACGCGUAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-137-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Prostaglandin G/H synthase 2 (PTGS2) [Driver; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker
Responsed Disease Cerebral ischaemic stroke ICD-11: 8B11
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Arachidonic acid metabolism hsa00590
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 SH-SY5Y cells Neuroblastoma Homo sapiens CVCL_0019
Response regulation MiR-137 is reported to regulate ferroptosis and to be involved in the neuroprotection against ischemic stroke. MiR-137overexpression boosts the neuroprotective effects of EPC-EXs against apoptosis and mitochondrial dysfunction in oxyHb-treated SH-SY5Y cells. Furthermore, EXsmiR-137 rather than EXs can restore the decrease in miR-137 levels and inhibit ferroptosis, and the protection mechanism might involve the MiR-137-COX2/PGE2 signaling pathway.
Cerebral ischaemic stroke [ICD-11: 8B11]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-137-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Arachidonic acid metabolism hsa00590
Cell Process Cell ferroptosis
Cell apoptosis
In Vitro Model
 SH-SY5Y cells Neuroblastoma Homo sapiens CVCL_0019
Response regulation MiR-137 is reported to regulate ferroptosis and to be involved in the neuroprotection against ischemic stroke. MiR-137overexpression boosts the neuroprotective effects of EPC-EXs against apoptosis and mitochondrial dysfunction in oxyHb-treated SH-SY5Y cells. Furthermore, EXsmiR-137 rather than EXs can restore the decrease in miR-137 levels and inhibit ferroptosis, and the protection mechanism might involve the MiR-137-COX2/PGE2 signaling pathway.
References
Ref 1 miR-137 boosts the neuroprotective effect of endothelial progenitor cell-derived exosomes in oxyhemoglobin-treated SH-SY5Y cells partially via COX2/PGE2 pathway. Stem Cell Res Ther. 2020 Oct 26;11(1):330. doi: 10.1186/s13287-020-01836-y.