Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20013)
Regulator Name hsa-miR-147a (miRNA)
Synonyms
hsa-miR-147a
    Click to Show/Hide
Gene Name hsa-miR-147a
Regulator Type miRNA
MiRBase ID MIMAT0000251
Sequence
GUGUGUGGAAAUGCUUCUGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-147a can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Solute carrier family 40 member 1 (SLC40A1) [Suppressor; Marker]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Marker/Suppressor
Responsed Disease Glioblastoma ICD-11: 2A00
 Disease Info 
Pathway Response Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 U-87MG cells Glioblastoma Homo sapiens CVCL_GP63
A-172 cells Glioblastoma Homo sapiens CVCL_0131
hMGCs (Human normal brain astroglia cells)
SVG p12 cells Normal Homo sapiens CVCL_3797
Response regulation miR-147a targets SLC40A1 to induce ferroptosis in human glioblastoma in vitro. Mechanistically, miR-147a directly bound to the 3'-untranslated region of SLC40A1 and inhibited SLC40A1-mediated iron export, thereby facilitating iron overload, lipid peroxidation, and ferroptosis.
Glioblastoma [ICD-11: 2A00]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-147a (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 U-87MG cells Glioblastoma Homo sapiens CVCL_GP63
A-172 cells Glioblastoma Homo sapiens CVCL_0131
hMGCs (Human normal brain astroglia cells)
SVG p12 cells Normal Homo sapiens CVCL_3797
Response regulation miR-147a targets SLC40A1 to induce ferroptosis in human glioblastoma in vitro. Mechanistically, miR-147a directly bound to the 3'-untranslated region of SLC40A1 and inhibited SLC40A1-mediated iron export, thereby facilitating iron overload, lipid peroxidation, and ferroptosis.
References
Ref 1 MicroRNA-147a Targets SLC40A1 to Induce Ferroptosis in Human Glioblastoma. Anal Cell Pathol (Amst). 2022 Jul 30;2022:2843990. doi: 10.1155/2022/2843990. eCollection 2022.