Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20009)
Regulator Name hsa-miR-101-3p (miRNA)
Synonyms
hsa-miR-101-3p
    Click to Show/Hide
Gene Name hsa-miR-101-3p
Regulator Type miRNA
MiRBase ID MIMAT0000099
Sequence
UACAGUACUGUGAUAACUGAA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-101-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
CDGSH iron-sulfur domain-containing protein 1 (CISD1) [Driver; Suppressor]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver/Suppressor
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell infiltration
In Vitro Model
 BEAS-2B cells Normal Homo sapiens CVCL_0168
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1975 cells Lung adenocarcinoma Homo sapiens CVCL_1511
Response regulation The study found GSEC, CISD1, ATP5MC3, and PGD to be upregulated, with miRNA-101-3p downregulated, in the setting of lung adenocarcinoma (LUAD). Immunohistochemical analysis revealed CISD1, ATP5MC3, and PGD overexpression in LUAD tissue samples; CISD1 knockdown was noted to significantly inhibit LUAD proliferation and migration.
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [2]
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
hTCs (Human tumour cells)
NCI-H460 cells Lung large cell carcinoma Homo sapiens CVCL_0459
GLC-82 cells Endocervical adenocarcinoma Homo sapiens CVCL_3371
SPC-A1 cells Endocervical adenocarcinoma Homo sapiens CVCL_6955
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
In Vivo Model
BALB/c mice (male, 6 weeks old, 20-22 g) were obtained from Vital River Laboratories (Beijing, China). Immunodeficient mice were randomly divided into groups (n = 6 per group). A549 cells (1 x 106) were injected subcutaneously into the dorsal left flank of nude mice. In each group, mice (20-25 g) were administered 100 uL of the nanomedicine working solution through the tail vein, once every 3 days.

    Click to Show/Hide
Response regulation The expression level of miR-101-3p negatively correlated with clinical tumour size and TNM stage. miR-101-3p restores ferroptosis in lung cancer cells by directly targeting TBLR1, which in turn promotes apoptosis and inhibits proliferation.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-101-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell infiltration
In Vitro Model
 BEAS-2B cells Normal Homo sapiens CVCL_0168
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H1975 cells Lung adenocarcinoma Homo sapiens CVCL_1511
Response regulation The study found GSEC, CISD1, ATP5MC3, and PGD to be upregulated, with miRNA-101-3p downregulated, in the setting of lung adenocarcinoma (LUAD). Immunohistochemical analysis revealed CISD1, ATP5MC3, and PGD overexpression in LUAD tissue samples; CISD1 knockdown was noted to significantly inhibit LUAD proliferation and migration.
Experiment 2 Reporting the Ferroptosis-centered Disease Response [2]
Target Regulator hsa-miR-101-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
hTCs (Human tumour cells)
NCI-H460 cells Lung large cell carcinoma Homo sapiens CVCL_0459
GLC-82 cells Endocervical adenocarcinoma Homo sapiens CVCL_3371
SPC-A1 cells Endocervical adenocarcinoma Homo sapiens CVCL_6955
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
In Vivo Model
BALB/c mice (male, 6 weeks old, 20-22 g) were obtained from Vital River Laboratories (Beijing, China). Immunodeficient mice were randomly divided into groups (n = 6 per group). A549 cells (1 x 106) were injected subcutaneously into the dorsal left flank of nude mice. In each group, mice (20-25 g) were administered 100 uL of the nanomedicine working solution through the tail vein, once every 3 days.

    Click to Show/Hide
Response regulation The expression level of miR-101-3p negatively correlated with clinical tumour size and TNM stage. miR-101-3p restores ferroptosis in lung cancer cells by directly targeting TBLR1, which in turn promotes apoptosis and inhibits proliferation.
References
Ref 1 Systematic Analysis and Validation of the Prognosis, Immunological Role and Biology Function of the Ferroptosis-Related lncRNA GSEC/miRNA-101-3p/CISD1 Axis in Lung Adenocarcinoma. Front Mol Biosci. 2022 Mar 7;8:793732. doi: 10.3389/fmolb.2021.793732. eCollection 2021.
Ref 2 Nanomedicine promotes ferroptosis to inhibit tumour proliferation in vivo. Redox Biol. 2021 Jun;42:101908. doi: 10.1016/j.redox.2021.101908. Epub 2021 Feb 20.