General Information of the Ferroptosis Regulator (ID: REG20008)
Regulator Name hsa-miR-93-5p (miRNA)
Synonyms
hsa-miR-93-5p
    Click to Show/Hide
Gene Name hsa-miR-93-5p
Regulator Type miRNA
MiRBase ID MIMAT0000093
Sequence
CAAAGUGCUGUUCGUGCAGGUAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-93-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Phospholipid hydroperoxide glutathione peroxidase (GPX4) [Suppressor]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Suppressor
Responsed Disease Ovarian dysfunction ICD-11: 5A80
Pathway Response Fatty acid metabolism hsa01212
NF-kappa B signaling pathway hsa04064
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
KGN cells Ovarian granulosa cell tumor Homo sapiens CVCL_0375
In Vivo Model
C57BL/6 J (3-week-old) female mice, weighing 15-20 g, were purchased from Beijing Vitalriver Laboratory Animal Technology Co Ltd., China. Experimental animals were randomly divided into control (glycerol treatment) and experimental groups (PCOS, DHEA treatment). The modeling method was as described previously. The PCOS model and control was verified successfully as our previous results, and ovarian tissue was extracted for RT-qPCR detection.

    Click to Show/Hide
Response regulation The overexpression of miR-93-5p can promote apoptosis by reducing the expression of Bcl2 and increasing ferroptosis by downregulating GPX4, SLC7A11 and Nrf2 expression in the KGN cell line. miR-93-5p promotes the apoptosis and ferroptosis in GC by regulating the NF-kB signaling pathway. Our study identified miR-93-5p as a new molecular target for improving the function of GCs in polycystic ovary syndrome patients.
Ovarian dysfunction [ICD-11: 5A80]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-93-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
NF-kappa B signaling pathway hsa04064
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
KGN cells Ovarian granulosa cell tumor Homo sapiens CVCL_0375
In Vivo Model
C57BL/6 J (3-week-old) female mice, weighing 15-20 g, were purchased from Beijing Vitalriver Laboratory Animal Technology Co Ltd., China. Experimental animals were randomly divided into control (glycerol treatment) and experimental groups (PCOS, DHEA treatment). The modeling method was as described previously. The PCOS model and control was verified successfully as our previous results, and ovarian tissue was extracted for RT-qPCR detection.

    Click to Show/Hide
Response regulation The overexpression of miR-93-5p can promote apoptosis by reducing the expression of Bcl2 and increasing ferroptosis by downregulating GPX4, SLC7A11 and Nrf2 expression in the KGN cell line. miR-93-5p promotes the apoptosis and ferroptosis in GC by regulating the NF-kB signaling pathway. Our study identified miR-93-5p as a new molecular target for improving the function of GCs in polycystic ovary syndrome patients.
References
Ref 1 MiR-93-5p promotes granulosa cell apoptosis and ferroptosis by the NF-kB signaling pathway in polycystic ovary syndrome. Front Immunol. 2022 Oct 19;13:967151. doi: 10.3389/fimmu.2022.967151. eCollection 2022.