General Information of the Ferroptosis Regulator (ID: REG50016)
Regulator Name hsa-mir-6852 (Precursor RNA)
Synonyms
hsa-mir-6852
    Click to Show/Hide
Gene Name hsa-mir-6852
Regulator Type Precursor RNA
MiRBase ID MI0022698
Sequence
UGCUGCCCUGGGGUUCUGAGGACAUGCUCUGACUCCCCUGAUGUCCUCUGUUCCUCAGGU
GCUGGG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-6852 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Lung cancer ICD-11: 2C25
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H358 cells Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1559
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
SPC-A1 cells Endocervical adenocarcinoma Homo sapiens CVCL_6955
Response regulation LSH induces ELAVL1 expression through the inactivation of p53 and ELAVL1 enhances LINC00336 levels through transcriptional regulation by interacting with LINC00336. Then, LINC00336 absorbs MIR6852 as a ceRNA, which increases the mRNA level of CBS, stimulating cell proliferation, colony formation, and tumor formation, and inhibiting ferroptosis in lung cancer.
Lung cancer [ICD-11: 2C25]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-6852 (Precursor RNA) Precursor RNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
NCI-H358 cells Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1559
PC-9 cells Lung adenocarcinoma Homo sapiens CVCL_B260
A-549 cells Lung adenocarcinoma Homo sapiens CVCL_0023
SPC-A1 cells Endocervical adenocarcinoma Homo sapiens CVCL_6955
Response regulation LSH induces ELAVL1 expression through the inactivation of p53 and ELAVL1 enhances LINC00336 levels through transcriptional regulation by interacting with LINC00336. Then, LINC00336 absorbs MIR6852 as a ceRNA, which increases the mRNA level of CBS, stimulating cell proliferation, colony formation, and tumor formation, and inhibiting ferroptosis in lung cancer.
References
Ref 1 Long noncoding RNA LINC00336 inhibits ferroptosis in lung cancer by functioning as a competing endogenous RNA. Cell Death Differ. 2019 Nov;26(11):2329-2343. doi: 10.1038/s41418-019-0304-y. Epub 2019 Feb 20.