Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG50010)
Regulator Name hsa-mir-137 (Precursor RNA)
Synonyms
hsa-mir-137
    Click to Show/Hide
Gene Name hsa-mir-137
Regulator Type Precursor RNA
MiRBase ID MI0000454
Sequence
GGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUU
AUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-mir-137 can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Neutral amino acid transporter B(0) (SLC1A5) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Responsed Drug Antagomir Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Glutamate metabolism hsa00250
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 A-375 cells Amelanotic melanoma Homo sapiens CVCL_0132
G-361 cells Melanoma Homo sapiens CVCL_1220
In Vivo Model
To generate murine subcutaneous tumors, melanoma cells (5 x 106 cells per mouse) were injected subcutaneously into the right posterior flanks of 7-week-old immunodeficient nude mice. When tumors reached a volume of approximately 50 mm3, mice were randomly allocated into groups and treated with erastin for 20 days. The erastin was dissolved in 5% dimethylsulfoxide (DMSO) + corn oil (C8267, Sigma).

    Click to Show/Hide
Response regulation MiR-137 negatively regulates ferroptosis by directly targeting glutamine transporter SLC1A5 in melanoma cells. Ectopic expression of miR-137 suppressed SLC1A5, resulting in decreased glutamine uptake and malondialdehyde (MDA) accumulation. Meanwhile, antagomir-mediated inactivation of endogenous miR-137 increased the sensitivity of melanoma cells to erastin- and RSL3-induced ferroptosis.
Melanoma [ICD-11: 2C30]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-mir-137 (Precursor RNA) Precursor RNA
 Regulator Info 
Responsed Drug Antagomir Investigative
 Drug Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Glutamate metabolism hsa00250
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 A-375 cells Amelanotic melanoma Homo sapiens CVCL_0132
G-361 cells Melanoma Homo sapiens CVCL_1220
In Vivo Model
To generate murine subcutaneous tumors, melanoma cells (5 x 106 cells per mouse) were injected subcutaneously into the right posterior flanks of 7-week-old immunodeficient nude mice. When tumors reached a volume of approximately 50 mm3, mice were randomly allocated into groups and treated with erastin for 20 days. The erastin was dissolved in 5% dimethylsulfoxide (DMSO) + corn oil (C8267, Sigma).

    Click to Show/Hide
Response regulation MiR-137 negatively regulates ferroptosis by directly targeting glutamine transporter SLC1A5 in melanoma cells. Ectopic expression of miR-137 suppressed SLC1A5, resulting in decreased glutamine uptake and malondialdehyde (MDA) accumulation. Meanwhile, antagomir-mediated inactivation of endogenous miR-137 increased the sensitivity of melanoma cells to erastin- and RSL3-induced ferroptosis.
Antagomir [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Inducer
Response Target Neutral amino acid transporter B(0) (SLC1A5) Driver
 Target Info 
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Glutamate metabolism hsa00250
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 A-375 cells Amelanotic melanoma Homo sapiens CVCL_0132
G-361 cells Melanoma Homo sapiens CVCL_1220
In Vivo Model
To generate murine subcutaneous tumors, melanoma cells (5 x 106 cells per mouse) were injected subcutaneously into the right posterior flanks of 7-week-old immunodeficient nude mice. When tumors reached a volume of approximately 50 mm3, mice were randomly allocated into groups and treated with erastin for 20 days. The erastin was dissolved in 5% dimethylsulfoxide (DMSO) + corn oil (C8267, Sigma).

    Click to Show/Hide
Response regulation MiR-137 negatively regulates ferroptosis by directly targeting glutamine transporter SLC1A5 in melanoma cells. Ectopic expression of miR-137 suppressed SLC1A5, resulting in decreased glutamine uptake and malondialdehyde (MDA) accumulation. Meanwhile, antagomir-mediated inactivation of endogenous miR-137 increased the sensitivity of melanoma cells to erastin- and RSL3-induced ferroptosis.
References
Ref 1 miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma. Cell Death Differ. 2018 Aug;25(8):1457-1472. doi: 10.1038/s41418-017-0053-8. Epub 2018 Jan 18.