Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20141)
Regulator Name hsa-miR-874-3p (miRNA)
Synonyms
hsa-miR-874-3p
    Click to Show/Hide
Gene Name hsa-miR-874-3p
Regulator Type miRNA
MiRBase ID MIMAT0004911
Sequence
CUGCCCUGGCCCGAGGGACCGA

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-874-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
SW620 cells Colon adenocarcinoma Homo sapiens CVCL_0547
SW480 cells Colon adenocarcinoma Homo sapiens CVCL_0546
FHC cells Normal Homo sapiens CVCL_3688
In Vivo Model
3 x 106 HCT116 cells with stable transfection of lentiviral vectors sh-circ_0007142 or sh-NC were harvested and resuspended in 0.2 mL PBS. Six-week-old male BALB/c nude mice (n = 12) from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) were injected with the prepared cell suspension (6 mice/group). During the 4-week observation period, tumour volume (length x width2/2) was detected every week.

    Click to Show/Hide
Response regulation Circ_0007142 regulated cancer progression and ferroptosis in colorectal cancer (CRC) cells partly by acting on the miR-874-3p/GDPD5 axis. This is a specific regulatory network for ferroptosis in CRC, and CRC treatment might be improved with circ_0007142 as a therapeutic target aiming at ferroptosis.
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-874-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
In Vitro Model
 HCT 116 cells Colon carcinoma Homo sapiens CVCL_0291
SW620 cells Colon adenocarcinoma Homo sapiens CVCL_0547
SW480 cells Colon adenocarcinoma Homo sapiens CVCL_0546
FHC cells Normal Homo sapiens CVCL_3688
In Vivo Model
3 x 106 HCT116 cells with stable transfection of lentiviral vectors sh-circ_0007142 or sh-NC were harvested and resuspended in 0.2 mL PBS. Six-week-old male BALB/c nude mice (n = 12) from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) were injected with the prepared cell suspension (6 mice/group). During the 4-week observation period, tumour volume (length x width2/2) was detected every week.

    Click to Show/Hide
Response regulation Circ_0007142 regulated cancer progression and ferroptosis in colorectal cancer (CRC) cells partly by acting on the miR-874-3p/GDPD5 axis. This is a specific regulatory network for ferroptosis in CRC, and CRC treatment might be improved with circ_0007142 as a therapeutic target aiming at ferroptosis.
References
Ref 1 Circ_0007142 downregulates miR-874-3p-mediated GDPD5 on colorectal cancer cells. Eur J Clin Invest. 2021 Jul;51(7):e13541. doi: 10.1111/eci.13541. Epub 2021 Apr 2.