Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20125)
Regulator Name hsa-miR-410-3p (miRNA)
Synonyms
hsa-miR-410-3p
    Click to Show/Hide
Gene Name hsa-miR-410-3p
Regulator Type miRNA
MiRBase ID MIMAT0002171
Sequence
AAUAUAACACAGAUGGCCUGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-410-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 MCF-10A cells Normal Homo sapiens CVCL_0598
MCF-7 cells Breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
Response regulation The LINC00665- miR-410-3p axis was identified as the most potential upstream ncRNA-related pathway of EMC2 in breast cancer. EMC2 levels were significantly positively correlated with tumor immune cell infiltration, immune cell biomarkers, and immune checkpoint expression.
Breast cancer [ICD-11: 2C60]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-410-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
 MCF-10A cells Normal Homo sapiens CVCL_0598
MCF-7 cells Breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
Response regulation The LINC00665- miR-410-3p axis was identified as the most potential upstream ncRNA-related pathway of EMC2 in breast cancer. EMC2 levels were significantly positively correlated with tumor immune cell infiltration, immune cell biomarkers, and immune checkpoint expression.
References
Ref 1 The ncRNA-Mediated Overexpression of Ferroptosis-Related Gene EMC2 Correlates With Poor Prognosis and Tumor Immune Infiltration in Breast Cancer. Front Oncol. 2021 Dec 8;11:777037. doi: 10.3389/fonc.2021.777037. eCollection 2021.