General Information of the Ferroptosis Regulator (ID: REG20111)
Regulator Name hsa-miR-129-5p (miRNA)
Synonyms
hsa-miR-129-5p
    Click to Show/Hide
Gene Name hsa-miR-129-5p
Regulator Type miRNA
MiRBase ID MIMAT0000242
Sequence
CUUUUUGCGGUCUGGGCUUGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-129-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Bladder cancer ICD-11: 2C94
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
5637 cells Bladder carcinoma Homo sapiens CVCL_0126
T24 cells Bladder carcinoma Homo sapiens CVCL_0554
SV-HUC-1 cells Normal Homo sapiens CVCL_3798
In Vivo Model
The male nude mice (BALB/c, aged 4-6 weeks, 18-20 g) were randomly divided into four groups (Sample size: 5-7 mice per group) and inoculated with cells as follows: sh-RP11-89 stable transfected 5637 Cell (1 x 107 cells); shNC-RP11-89 stable transfected 5637 Cell (1 x 107 cells); sh-RP11-89 stable transfected 5637 Cell + antagomiR-129-5p (1 x 107 cells; 10 nmol antagomiR-129-5p injection/mouse, 3 days after tumor formation); and sh-RP11-89 stable transfected 5637 Cell + miR-129-5p NC group (1 x 107 cells; 10 nmol miR-129-5p NC injection/mouse, 3 days after tumor formation). Cells were mixed with matrigel (1:2) and inoculated subcutaneously at the right rear back region.

    Click to Show/Hide
Response regulation RP11-89 "sponges" miR-129-5p and upregulates PROM2. RP11-89 promoted cell proliferation, migration and tumorigenesis and inhibited cell cycle arrest via the miR-129-5p/PROM2 axis. RP11-89 may serve as a potential biomarker for targeted therapy in bladder cancer.
Bladder cancer [ICD-11: 2C94]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-129-5p (miRNA) miRNA
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell invasion
In Vitro Model
5637 cells Bladder carcinoma Homo sapiens CVCL_0126
T24 cells Bladder carcinoma Homo sapiens CVCL_0554
SV-HUC-1 cells Normal Homo sapiens CVCL_3798
In Vivo Model
The male nude mice (BALB/c, aged 4-6 weeks, 18-20 g) were randomly divided into four groups (Sample size: 5-7 mice per group) and inoculated with cells as follows: sh-RP11-89 stable transfected 5637 Cell (1 x 107 cells); shNC-RP11-89 stable transfected 5637 Cell (1 x 107 cells); sh-RP11-89 stable transfected 5637 Cell + antagomiR-129-5p (1 x 107 cells; 10 nmol antagomiR-129-5p injection/mouse, 3 days after tumor formation); and sh-RP11-89 stable transfected 5637 Cell + miR-129-5p NC group (1 x 107 cells; 10 nmol miR-129-5p NC injection/mouse, 3 days after tumor formation). Cells were mixed with matrigel (1:2) and inoculated subcutaneously at the right rear back region.

    Click to Show/Hide
Response regulation RP11-89 "sponges" miR-129-5p and upregulates PROM2. RP11-89 promoted cell proliferation, migration and tumorigenesis and inhibited cell cycle arrest via the miR-129-5p/PROM2 axis. RP11-89 may serve as a potential biomarker for targeted therapy in bladder cancer.
References
Ref 1 LncRNA RP11-89 facilitates tumorigenesis and ferroptosis resistance through PROM2-activated iron export by sponging miR-129-5p in bladder cancer. Cell Death Dis. 2021 Nov 2;12(11):1043. doi: 10.1038/s41419-021-04296-1.