General Information of the Ferroptosis Regulator (ID: REG20110)
Regulator Name hsa-miR-106a-5p (miRNA)
Synonyms
hsa-miR-106a-5p
    Click to Show/Hide
Gene Name hsa-miR-106a-5p
Regulator Type miRNA
MiRBase ID MIMAT0000103
Sequence
AAAAGUGCUUACAGUGCAGGUAG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-106a-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Breast cancer ICD-11: 2C60
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
T-47D cells Invasive breast carcinoma Homo sapiens CVCL_0553
In Vivo Model
The effect of levobupivacaine on tumor growth of breast cancer in vivo was assessed in the Balb/c nude mice (male, 4-week-old) (n = 5). About 1 x 107 cells MDA-MB-231 cells transfected with control shRNA or circRHOT1 shRNA were subcutaneously injected into the mice. After 5 days of injection, we measured tumor growth every 5 days. We sacrificed the mice after 30 days of injection, and tumors were scaled.

    Click to Show/Hide
Response regulation The depletion of circRHOT1 was able to repress the proliferation and induce the apoptosis of breast cancer cells. CircRHOT1 knockdown could remarkably inhibit the invasion and migration in the breast cancer cells. Mechanically, circRHOT1 contributed to malignant progression and attenuated ferroptosis in breast cancer by the miR-106a-5p/STAT3 axis.
Breast cancer [ICD-11: 2C60]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-106a-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell apoptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
MDA-MB-231 cells Breast adenocarcinoma Homo sapiens CVCL_0062
T-47D cells Invasive breast carcinoma Homo sapiens CVCL_0553
In Vivo Model
The effect of levobupivacaine on tumor growth of breast cancer in vivo was assessed in the Balb/c nude mice (male, 4-week-old) (n = 5). About 1 x 107 cells MDA-MB-231 cells transfected with control shRNA or circRHOT1 shRNA were subcutaneously injected into the mice. After 5 days of injection, we measured tumor growth every 5 days. We sacrificed the mice after 30 days of injection, and tumors were scaled.

    Click to Show/Hide
Response regulation The depletion of circRHOT1 was able to repress the proliferation and induce the apoptosis of breast cancer cells. CircRHOT1 knockdown could remarkably inhibit the invasion and migration in the breast cancer cells. Mechanically, circRHOT1 contributed to malignant progression and attenuated ferroptosis in breast cancer by the miR-106a-5p/STAT3 axis.
References
Ref 1 Circular RNA RHOT1 promotes progression and inhibits ferroptosis via mir-106a-5p/STAT3 axis in breast cancer. Aging (Albany NY). 2021 Mar 3;13(6):8115-8126. doi: 10.18632/aging.202608. Epub 2021 Mar 3.