General Information of the Ferroptosis Regulator (ID: REG20107)
Regulator Name hsa-let-7b-5p (miRNA)
Synonyms
hsa-let-7b-5p
    Click to Show/Hide
Gene Name hsa-let-7b-5p
Regulator Type miRNA
MiRBase ID MIMAT0000063
Sequence
UGAGGUAGUAGGUUGUGUGGUU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-let-7b-5p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
hBMSCs (Bone marrow stromal cells)
K-562 cells Chronic myelogenous leukemia Homo sapiens CVCL_0004
THP-1 cells Childhood acute monocytic leukemia Homo sapiens CVCL_0006
HL-60 cells Adult acute myeloid leukemia Homo sapiens CVCL_0002
MOLM-13 cells Adult acute myeloid leukemia Homo sapiens CVCL_2119
In Vivo Model
All BALB/C male nude mice (6 weeks old), purchased from Beijing Weitong lihua Experimental Animal Technology Co., Ltd, were maintained in pathogen-free facilities. The K562 or HL-60 cells (3 x 106, 200 ul) transfected with circKDM4C, vector, si-NC, or si-circKDM4C were subcutaneously injected into the right flank of nude mice (9 mice each group) for tumorigenesis. The maximum (Length) and minimum (Width) length of the tumors were measured.

    Click to Show/Hide
Response regulation The overexpression of circKDM4C in acute myeloid leukemia (AML) cell lines inhibited the cell proliferation, migration, invasion, and promoted ferroptosis. The expression of circKDM4C and hsa-let-7b-5p are negatively correlated, while circKDM4C and p53 are positively correlated to AML patients. Moreover, circKDM4C induces ferroptosis by sponging hsa-let-7b-5p which upregulates the expression of P53.
Acute myeloid leukaemia [ICD-11: 2A60]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-let-7b-5p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
Cell migration
Cell invasion
In Vitro Model
hBMSCs (Bone marrow stromal cells)
K-562 cells Chronic myelogenous leukemia Homo sapiens CVCL_0004
THP-1 cells Childhood acute monocytic leukemia Homo sapiens CVCL_0006
HL-60 cells Adult acute myeloid leukemia Homo sapiens CVCL_0002
MOLM-13 cells Adult acute myeloid leukemia Homo sapiens CVCL_2119
In Vivo Model
All BALB/C male nude mice (6 weeks old), purchased from Beijing Weitong lihua Experimental Animal Technology Co., Ltd, were maintained in pathogen-free facilities. The K562 or HL-60 cells (3 x 106, 200 ul) transfected with circKDM4C, vector, si-NC, or si-circKDM4C were subcutaneously injected into the right flank of nude mice (9 mice each group) for tumorigenesis. The maximum (Length) and minimum (Width) length of the tumors were measured.

    Click to Show/Hide
Response regulation The overexpression of circKDM4C in acute myeloid leukemia (AML) cell lines inhibited the cell proliferation, migration, invasion, and promoted ferroptosis. The expression of circKDM4C and hsa-let-7b-5p are negatively correlated, while circKDM4C and p53 are positively correlated to AML patients. Moreover, circKDM4C induces ferroptosis by sponging hsa-let-7b-5p which upregulates the expression of P53.
References
Ref 1 CircKDM4C upregulates P53 by sponging hsa-let-7b-5p to induce ferroptosis in acute myeloid leukemia. Environ Toxicol. 2021 Jul;36(7):1288-1302. doi: 10.1002/tox.23126. Epub 2021 Mar 18.