General Information of the Ferroptosis Regulator (ID: REG20096)
Regulator Name mmu-miR-149-3p (miRNA)
Synonyms
mmu-miR-149-3p
    Click to Show/Hide
Gene Name mmu-miR-149-3p
Regulator Type miRNA
MiRBase ID MIMAT0016990
Sequence
GAGGGAGGGACGGGGGCGGUGC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-149-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Browse Drug
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Sepsis ICD-11: 1G40
Responsed Drug Resveratrol Phase 3
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
Clean male C57BL/6 mice (8-10 wk old, weighing 25-29 g) were purchased from Beijing HFK Bioscience Co. Ltd. The 90 mice were randomly assigned into nine groups after 1 wk of adaptive feeding with 10 mice in each group: normal group (intraperitoneally injected with the same amount of PBS), LPS group [intraperitoneally injected with 15 mg/kg LPS (Sigma-Aldrich, St. Louis, Cat. No. L2880)], LPS + Rsv group (intraperitoneally injected with 15 mg/kg LPS and pretreated with 50 mg/kg resveratrol; 30), LPS + antagomiR-NC group [intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 0.4 pmol/uL antagomiR-NC group (Merck, Darmstadt, Germany)], LPS + miR-149 antagomiR group (intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 0.4 pmol/uL miR-149 antagomiR), LPS + Rsv + miR-149 antagomiR group (intraperitoneally injected with 15 mg/kg LPS, pretreated with 50 mg/kg resveratrol, and simultaneously injected with 0.4 pmol/uL miR-149 antagomiR), LPS + Fer-1 group (intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 2.5 umol/kg ferroptosis inhibitor ferrostatin-1), and LPS + Rsv + Fer-1 group (intraperitoneally injected with 15 mg/kg LPS, pretreated with 50 mg/kg resveratrol, and simultaneously injected with 2.5 umol/kg ferroptosis inhibitor ferrostatin-1.

    Click to Show/Hide
Response regulation Resveratrol inhibited ferroptosis by upregulating miR-149 and downregulating HMGB1, thus improving endotoxemia-induced myocardial injury in mice.
Sepsis [ICD-11: 1G40]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-149-3p (miRNA) miRNA
Responsed Drug Resveratrol Phase 3
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
Clean male C57BL/6 mice (8-10 wk old, weighing 25-29 g) were purchased from Beijing HFK Bioscience Co. Ltd. The 90 mice were randomly assigned into nine groups after 1 wk of adaptive feeding with 10 mice in each group: normal group (intraperitoneally injected with the same amount of PBS), LPS group [intraperitoneally injected with 15 mg/kg LPS (Sigma-Aldrich, St. Louis, Cat. No. L2880)], LPS + Rsv group (intraperitoneally injected with 15 mg/kg LPS and pretreated with 50 mg/kg resveratrol; 30), LPS + antagomiR-NC group [intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 0.4 pmol/uL antagomiR-NC group (Merck, Darmstadt, Germany)], LPS + miR-149 antagomiR group (intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 0.4 pmol/uL miR-149 antagomiR), LPS + Rsv + miR-149 antagomiR group (intraperitoneally injected with 15 mg/kg LPS, pretreated with 50 mg/kg resveratrol, and simultaneously injected with 0.4 pmol/uL miR-149 antagomiR), LPS + Fer-1 group (intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 2.5 umol/kg ferroptosis inhibitor ferrostatin-1), and LPS + Rsv + Fer-1 group (intraperitoneally injected with 15 mg/kg LPS, pretreated with 50 mg/kg resveratrol, and simultaneously injected with 2.5 umol/kg ferroptosis inhibitor ferrostatin-1.

    Click to Show/Hide
Response regulation Resveratrol inhibited ferroptosis by upregulating miR-149 and downregulating HMGB1, thus improving endotoxemia-induced myocardial injury in mice.
Resveratrol [Phase 3]
In total 1 item(s) under this drug
Experiment 1 Reporting the Ferroptosis-centered Drug Response [1]
Drug for Ferroptosis Suppressor
Response Target Unspecific Target
Responsed Disease Sepsis ICD-11: 1G40
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Glutathione metabolism hsa00480
Cell Process Cell ferroptosis
In Vitro Model
hCMs (Human cardiomyocytes)
In Vivo Model
Clean male C57BL/6 mice (8-10 wk old, weighing 25-29 g) were purchased from Beijing HFK Bioscience Co. Ltd. The 90 mice were randomly assigned into nine groups after 1 wk of adaptive feeding with 10 mice in each group: normal group (intraperitoneally injected with the same amount of PBS), LPS group [intraperitoneally injected with 15 mg/kg LPS (Sigma-Aldrich, St. Louis, Cat. No. L2880)], LPS + Rsv group (intraperitoneally injected with 15 mg/kg LPS and pretreated with 50 mg/kg resveratrol; 30), LPS + antagomiR-NC group [intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 0.4 pmol/uL antagomiR-NC group (Merck, Darmstadt, Germany)], LPS + miR-149 antagomiR group (intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 0.4 pmol/uL miR-149 antagomiR), LPS + Rsv + miR-149 antagomiR group (intraperitoneally injected with 15 mg/kg LPS, pretreated with 50 mg/kg resveratrol, and simultaneously injected with 0.4 pmol/uL miR-149 antagomiR), LPS + Fer-1 group (intraperitoneally injected with 15 mg/kg LPS, and simultaneously injected with 2.5 umol/kg ferroptosis inhibitor ferrostatin-1), and LPS + Rsv + Fer-1 group (intraperitoneally injected with 15 mg/kg LPS, pretreated with 50 mg/kg resveratrol, and simultaneously injected with 2.5 umol/kg ferroptosis inhibitor ferrostatin-1.

    Click to Show/Hide
Response regulation Resveratrol inhibited ferroptosis by upregulating miR-149 and downregulating HMGB1, thus improving endotoxemia-induced myocardial injury in mice.
References
Ref 1 Resveratrol mediates the miR-149/HMGB1 axis and regulates the ferroptosis pathway to protect myocardium in endotoxemia mice. Am J Physiol Endocrinol Metab. 2022 Jul 1;323(1):E21-E32. doi: 10.1152/ajpendo.00227.2021. Epub 2022 May 9.