General Information of the Ferroptosis Regulator (ID: REG20083)
Regulator Name mmu-miR-351-3p (miRNA)
Synonyms
mmu-miR-351-3p
    Click to Show/Hide
Gene Name mmu-miR-351-3p
Regulator Type miRNA
MiRBase ID MIMAT0017042
Sequence
GGUCAAGAGGCGCCUGGGAAC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
mmu-miR-351-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Chronic heart failure ICD-11: BD1Z
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Necroptosis hsa04217
NF-kappa B signaling pathway hsa04064
Cell Process Cell ferroptosis
Cell pyroptosis
In Vitro Model
rHTs (Rat hippocampal tissues)
In Vivo Model
Male wild-type (WT) C57BL/6J mice aged 8 weeks were obtained from the Experimental Animal Center, Guangzhou University of Chinese Medicine. Sham and TAC mice received corresponding isotype i.p. injections. TAC + AAVMLK3- mice were generated by intravenous (i.v.) injection of adeno-associated viral vector-MLK3 vector (AAVMLK3-) (GenePharma, Shanghai, China) 14 and 21 days before TAC surgery. Sham + AAVNC and TAC + AAVNC mice received AAVNC i.v. injections. TAC + antagomir and TAC + agomir were generated by i.v. injection of antagomir and agomir (30 pmol/g) 14 and 21 days before TAC surgery, respectively.

    Click to Show/Hide
Response regulation MLK3 (MAP3K11) mainly regulates the JNK/p53 signaling pathway-mediated oxidative stress and that ferroptosis causes myocardial fibrosis in the advanced stages of chronic heart failure (CHF). Promoting the expression of miR-351 can inhibit the expression of MLK3, and significantly improve cardiac function in mice subjected to TAC.
Chronic heart failure [ICD-11: BD1Z]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator mmu-miR-351-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Necroptosis hsa04217
NF-kappa B signaling pathway hsa04064
Cell Process Cell ferroptosis
Cell pyroptosis
In Vitro Model
rHTs (Rat hippocampal tissues)
In Vivo Model
Male wild-type (WT) C57BL/6J mice aged 8 weeks were obtained from the Experimental Animal Center, Guangzhou University of Chinese Medicine. Sham and TAC mice received corresponding isotype i.p. injections. TAC + AAVMLK3- mice were generated by intravenous (i.v.) injection of adeno-associated viral vector-MLK3 vector (AAVMLK3-) (GenePharma, Shanghai, China) 14 and 21 days before TAC surgery. Sham + AAVNC and TAC + AAVNC mice received AAVNC i.v. injections. TAC + antagomir and TAC + agomir were generated by i.v. injection of antagomir and agomir (30 pmol/g) 14 and 21 days before TAC surgery, respectively.

    Click to Show/Hide
Response regulation MLK3 (MAP3K11) mainly regulates the JNK/p53 signaling pathway-mediated oxidative stress and that ferroptosis causes myocardial fibrosis in the advanced stages of chronic heart failure (CHF). Promoting the expression of miR-351 can inhibit the expression of MLK3, and significantly improve cardiac function in mice subjected to TAC.
References
Ref 1 Pyroptosis and ferroptosis induced by mixed lineage kinase 3 (MLK3) signaling in cardiomyocytes are essential for myocardial fibrosis in response to pressure overload. Cell Death Dis. 2020 Jul 24;11(7):574. doi: 10.1038/s41419-020-02777-3.