Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20045)
Regulator Name hsa-miR-21-3p (miRNA)
Synonyms
hsa-miR-21-3p
    Click to Show/Hide
Gene Name hsa-miR-21-3p
Regulator Type miRNA
MiRBase ID MIMAT0004494
Sequence
CAACACCAGUCGAUGGGCUGU

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-21-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Melanoma ICD-11: 2C30
 Disease Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 WM793 cells Melanoma Homo sapiens CVCL_8787
A2058 cells Amelanotic melanoma Homo sapiens CVCL_1059
A-375 cells Amelanotic melanoma Homo sapiens CVCL_0132
Hs 294T cells Melanoma Homo sapiens CVCL_0331
B16-F10 cells Melanoma Mus musculus CVCL_0159
In Vivo Model
In liproxstatin-1 rescue experiment, 5 x 105 B16F10 cells were subcutaneously injected into the right flank of C57BL/6 mice. When the tumor grows to 50 mm3, 100 ug anti-PD-1 antibody (Bio X Cell, USA), 30 mg/kg liproxstatin-1 (MedChemExpress, USA) or both were administered intraperitoneally to each mouse. Anti-PD-1 antibody was administered every 3 days and liproxstatin-1 was administered every day.

    Click to Show/Hide
Response regulation ATF3-induced miR-21-3p upregulation contributed to the efficacy of anti-PD-1 immunotherapy by facilitating melanoma cell ferroptosis via the suppression of the novel target TXNRD1 and lipid peroxidation. Nanoparticle delivery of miR-21-3p could sensitize melanoma cells to anti-PD-1 immunotherapy by facilitating ferroptosis.
Melanoma [ICD-11: 2C30]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-21-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Fatty acid metabolism hsa01212
Cell Process Cell ferroptosis
In Vitro Model
 WM793 cells Melanoma Homo sapiens CVCL_8787
A2058 cells Amelanotic melanoma Homo sapiens CVCL_1059
A-375 cells Amelanotic melanoma Homo sapiens CVCL_0132
Hs 294T cells Melanoma Homo sapiens CVCL_0331
B16-F10 cells Melanoma Mus musculus CVCL_0159
In Vivo Model
In liproxstatin-1 rescue experiment, 5 x 105 B16F10 cells were subcutaneously injected into the right flank of C57BL/6 mice. When the tumor grows to 50 mm3, 100 ug anti-PD-1 antibody (Bio X Cell, USA), 30 mg/kg liproxstatin-1 (MedChemExpress, USA) or both were administered intraperitoneally to each mouse. Anti-PD-1 antibody was administered every 3 days and liproxstatin-1 was administered every day.

    Click to Show/Hide
Response regulation ATF3-induced miR-21-3p upregulation contributed to the efficacy of anti-PD-1 immunotherapy by facilitating melanoma cell ferroptosis via the suppression of the novel target TXNRD1 and lipid peroxidation. Nanoparticle delivery of miR-21-3p could sensitize melanoma cells to anti-PD-1 immunotherapy by facilitating ferroptosis.
References
Ref 1 Nanoparticle delivery of miR-21-3p sensitizes melanoma to anti-PD-1 immunotherapy by promoting ferroptosis. J Immunother Cancer. 2022 Jun;10(6):e004381. doi: 10.1136/jitc-2021-004381.