General Information of the Ferroptosis Regulator (ID: REG20041)
Regulator Name hsa-miR-494-3p (miRNA)
Synonyms
hsa-miR-494-3p
    Click to Show/Hide
Gene Name hsa-miR-494-3p
Regulator Type miRNA
MiRBase ID MIMAT0002816
Sequence
UGAAACAUACACGGGAAACCUC

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-494-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Unspecific Target [Unspecific Target]
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Responsed Disease Myeloid leukaemia ICD-11: 2B33
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Gluconeogenesis hsa00010
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell proliferation
Cell apoptosis
In Vitro Model
Kasumi-1 cells Acute myeloid leukemia Homo sapiens CVCL_0589
KG-1 cells Adult acute myeloid leukemia Homo sapiens CVCL_0374
Response regulation Circ_0000745 promoted cell cycle progression and glycolytic metabolism and inhibited the apoptosis and ferroptosis of acute lymphoblastic leukemia cells by regulating miR-494-3p/NET1 axis. Circ_0000745/ miR-494-3p/NET1 axis may provide novel potential targets for the diagnosis and treatment of acute lymphoblastic leukemia (ALL).
Myeloid leukaemia [ICD-11: 2B33]
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-494-3p (miRNA) miRNA
Pathway Response Fatty acid metabolism hsa01212
Ferroptosis hsa04216
Gluconeogenesis hsa00010
Apoptosis hsa04210
Cell Process Cell ferroptosis
Cell proliferation
Cell apoptosis
In Vitro Model
Kasumi-1 cells Acute myeloid leukemia Homo sapiens CVCL_0589
KG-1 cells Adult acute myeloid leukemia Homo sapiens CVCL_0374
Response regulation Circ_0000745 promoted cell cycle progression and glycolytic metabolism and inhibited the apoptosis and ferroptosis of acute lymphoblastic leukemia cells by regulating miR-494-3p/NET1 axis. Circ_0000745/ miR-494-3p/NET1 axis may provide novel potential targets for the diagnosis and treatment of acute lymphoblastic leukemia (ALL).
References
Ref 1 Circ_0000745 promotes acute lymphoblastic leukemia progression through mediating miR-494-3p/NET1 axis. Hematology. 2022 Dec;27(1):11-22. doi: 10.1080/16078454.2021.2008590.