Ferroptosis Regulator Information

General Information of the Ferroptosis Regulator (ID: REG20039)
Regulator Name hsa-miR-338-3p (miRNA)
Synonyms
hsa-miR-338-3p
    Click to Show/Hide
Gene Name hsa-miR-338-3p
Regulator Type miRNA
MiRBase ID MIMAT0000763
Sequence
UCCAGCAUCAGUGAUUUUGUUG

    Click to Show/Hide
Full List of the Ferroptosis Target of This Regulator and Corresponding Disease/Drug Response(s)
hsa-miR-338-3p can regulate the following target(s), and cause disease/drug response(s). You can browse detail information of target(s) or disease/drug response(s).
Browse Target
Browse Disease
Neutral amino acid transporter B(0) (SLC1A5) [Driver]
 Target Info 
In total 1 item(s) under this target
Experiment 1 Reporting the Ferroptosis Target of This Regulator [1]
Target for Ferroptosis Driver
Responsed Disease Retinopathy ICD-11: 9B71
 Disease Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation High glucose upregulated miR-338-3p to cause SLC1A5-deficiency in RPE cells, resulting in oxidative stress mediated cell ferroptosis, which further caused RPE cell death and aggravate diabetic retinopathy (DR) progression.
Retinopathy [ICD-11: 9B71]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the Ferroptosis-centered Disease Response [1]
Target Regulator hsa-miR-338-3p (miRNA) miRNA
 Regulator Info 
Pathway Response Ferroptosis hsa04216
Cell Process Cell ferroptosis
Cell proliferation
In Vitro Model
 ARPE-19 cells Normal Homo sapiens CVCL_0145
Response regulation High glucose upregulated miR-338-3p to cause SLC1A5-deficiency in RPE cells, resulting in oxidative stress mediated cell ferroptosis, which further caused RPE cell death and aggravate diabetic retinopathy (DR) progression.
References
Ref 1 A novel miR-338-3p/SLC1A5 axis reprograms retinal pigment epithelium to increases its resistance to high glucose-induced cell ferroptosis. J Mol Histol. 2022 Jun;53(3):561-571. doi: 10.1007/s10735-022-10070-0. Epub 2022 Mar 23.